Description :
From Genome Similarity Track
Location :
Scaffold_65:1162- 2451
Sequence
1289 bases(100 bases per row)
GTCTGCTGAGGTAAAGGAAAACGACAGCTGTGAGATTCGAACTCACGCGGGTTGCCCCATTAACTTAAGCAGGCTAACGCCTTTAACCACTCGGCCAAGC
TGTCATCGCTTATGTCATCAAAAACATAGATGTCCACTCCCACCTCTCATCAGATTCAAATTCAACAAACCAAACTCACGACCACCCCGCACATACCGTC
ACGACCTGTGCTACCACCCATAGATACGGCGCATACCGTACGCCTTTATCAAATACTGACAACACTAAGAGAGAACATCCACACTCGCCGGCAGCACAAT
CTTCAATCGTCAAAACATTCAGCGTCTTTCACCTCTGCATGTCTTCGGCTGGTGGGATGTTGGCCACCACCTACGTACGCTGCTTATGTTTCTACCCGCC
ACGGATATCATCTCGTACATAATACTCTCAACAGAGGGGGGGGGCGAGTTGCACGGTCAGACTCAGTGACATCATGCTAGCGGATCCGACAGTTGTTGTC
GCTCGTTATGATATCTTTTTTATATATTTTCACAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGTTTCTCCGGGCTCGATCCA
GGTCGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCGTACAACGGTCGCCGTCCGCTGAGCTGGATTCGCATCTCGTCCGGGAAACACAGTGTCCCA
TCCGCCAGATCCAACCTTACTCCGGCTGGTACCATGAAATCCATTCCGAGGATGGCGGCTTGACCAGCGAGATCTCCAACCCAAATATC