Description :
From Genome Similarity Track
Location :
contig_53:116193- 117593
Transcript NameFunction/comments
g10319.t1hypothetical protein

Sequence
1400 bases(100 bases per row)
CACGCGAGGAGGGCGGGAACGCGCGGGTGCCGCGCGATATTCACGAAAAAGGGGTCAGCCCCGGCGACGCGTGTTCCGTGTTGTTCAGCGCAAACTCGGC
AGGTGGCAAGAAGGAGCTCCAACTCGTGAACGAGGTCGCGTAGCTTCGAAGGACATCTTCGAAGACTCGGTTGACCCGCTCCGTCTGTCCATCCTTCTCC
AGATGCGTCGCCGTTGACATGAGCAGCTTCGTTTCCAGAAGCTGGAAGAGGCTCGACCAGACCGCCGATGTGAACTGAGGATTGCGGTCAGAGGTGATCG
ATTCGGATAAGCCGTGGTGTCGAAAGGCCGCATTAACGAAATGCACCACGGACTCAGCCGCGGTGATCATGTCGGACACCGGAATGAGTTGGGCCATCTT
GCTGAACCTATCAACGAACACAATACACCAATTCGACCATTCACATTAGGCGGAAGCCCGAAGATGAAGTCTATCAACACTGAGCGTCACGCCTCAGTTG
CAATCGGTAGGGCTCGCAGGGAAACCTGCGACGACTTTGACGGCTTCACGCGCTGGCAAATCTCGCAAATACGGACTCACTTGCGCACCCACTTGTACAT
GTGGGGCCAACAGAGTCGAGGGACATTGCTGCGAAAGATTTTCCGCGGCCCAAGTGACCACCGATAGGGCTGTCTTGGAACTCGTGGATGATCCGAGCGC
ACAGGGCATCGTTGTTCGGGATGACGATGCGGGGAGCATCGAGCCGATCGGTGTTGAACGTCAGCGGATTGCCGTCGAGTTGATATCAGTTGACTTGAAT
GTACGTGTTGTTCGATAGCACGCCAAGTGTTTTATCACTGGGGGGGGATGCGCGAGGATGGCGGCATATACCGCGTCGTTGTTGTTCGCAACGACGATCT
GTTCGCGTAACGGCATTTCTGGAGTCACGTTCATCAGGTTGACACCTGATGCAAAGCACATCGCGCAGTGATCTTCGTCATCCTCGTCGTCGTCAATCAC
TTGACGACCCCGCATCGCACGTGGATCACAGTCTGGACGCCGAGACAGAGCGTCGGCGAGGATGTTGTTCTTGTCGGGCTAGTGCACGACGATGTTGCAC
TCAGCGAATAACGACAACCATCGTATCATGCGTTGGAACAAATGTGGGGACTTTATCGCTGCCCACAGTGATACGATGCGTGATTTGTGTACACCACGAA
CCTCTGTTCTCCGAGCAGGTACACTCTGAATTTGATCAGAGCGTAACGCATCGTAAGGAGTTTTTTATTTGGAATAGTTGCGTTCGGCCGGCTTCATCTG
TCGCGATTGATAGCTCACGACCTGCATTGTCAAACTGCATGAGCGCACACCCGATGGCGAAGACGCTAGTGTCGTAGACGACGTGGAACGGCTTTCTTGG