Description :
From Genome Similarity Track
Location :
contig_53:116179- 117579
Transcript NameFunction/comments
g10778.t1hypothetical protein

Sequence
1400 bases(100 bases per row)
CACGCGAGGAGGGCGGGAACGCGCGGGTGCCGCGCGATATTCACGAAAAAGGGGTCAGCCCCGGCGACGCGTGTTCCGTGTTGTTCAGCGCAAACTCGGC
AGGTGGCAAGAAGGAGCTCCAACTCGTGAACGAGGTCGCGTAGCTTCGAAGGACATCTTCGAAGACTCGGTTGACCCGCTCCGTCTGTCCATCCTTCTCC
AGATGCGTCGCCGTTGACATGAGCAGCTTCGTTTCCAGAAGCTGGAAGAGGCTCGACCAGACCGCCGATGTGAACTGAGGATTGCGGTCAGAGGTGATCG
ATTCGGATAAGCCGTGGTGTCGAAAGGCCGCATTAACGAAATGCACCACGGACTCAGCCGCGATGATCATGTCGGACACCGGAATGAGTTGCACCATCTT
GCTGAACCTATCAACGAACACAATACACCAATTCGACCATTCACATTAGGCGGAAGCCCGAAGATGAAGTCTATCAACACTGAGCGTCACGCCTCAGTTG
CAATCGGTAGGGCTCGCAGGGAAACCTGCGACGACTTCGACGGCTTCACGCGCTGGCAAAACTCGCAAATACGGGCCCACTTACGCACCCACTTGTACAT
GTGGGGCCAACAGAGTCGAGGGACACTGCTGCGAAAGATTTTCCGCGGCCCAAGTGACCACCGATAGGGCTGTCTTGGAACTCGTGGATGATCCGAGCGC
ACAGGGCATCGTTGTTCGGGATGACGATGCGGGGAGCATCGAGCCGATCGGTGTTGAACGTCAGCGGATTGCCGTCGAGTTGATATCAGTTGACTTGAAT
GTACGTGTTGTTCGATAGCACGCCAAGTGTTTTATCACTGGGGGGGGATGCGCGAGGATGGCGGCATATACCGCGTCGTTGTTGTTCGCAGCGACGATCT
GTTCGCGTAACGGCATTTCTGGAGTCACGTTTATCAGGTTGACACCTGATGCAAAGCACATTGCGCAGTGATCTTAGTCATCCTCGACGTCGTCAATCAC
TTGACGACCGAGCAACGCACGTGGATCATAGTCTGGACGCCGAGGCAGAGCGTCGGCGAGGAAGTTGTTCTTGCCGGGCTAGTGCACGACGATGTTGTAA
TCAGCGAATAACGACAACCATCGTGGCATGCGTTGGGACAGATGTGGGGACTTTATCGCTGCCCACAGTGATACGATGCGTGATTTGTGTACACCACGAA
CCTATGTTCTCCGAGCAGGTACACTCTGAATTTGATCAGAGCGTAACGCATGGTAAGGAGTTTTTTATTTGGAATAGTTGCGTTCGGCCGGCTTCATCTG
TCGCGATTGATAGCTCACGACCTGCATTGTCAAACTGCATGAGCGCACACCCGATAGCGAAGACGCTAGTGTCGTAGACGACGTGGAACGGCTTTCTTGG