Description :
From Genome Similarity Track
Location :
contig_62:11616- 12679
Transcript NameFunction/comments
g11388.t1hypothetical protein

Sequence
1063 bases(100 bases per row)
TCGGCATCTGGGAGCCGTAGTAGCGTCAATTGATCAGCCAGATCTTGATCTCCGAGGGTCTCGACAAAGCGATCCACATGTTCCCGGCGATCTTTCGGTT
CCCCGTCCTTGATCTTGAGGCGGGTACGTAGAGCAGCAACGTTCAGAGGTGGAGATACTCTAATGGTGATTCATCCGACCGCTTACGTGCGTGATAATAC
TGACAGGCAACCGAAACACCTAATCCACAGTATTGCACCTGGAAATAGCGCAGCAGATCACTCCGCTTGCTCCGAGTAGTTCGGCTTAGCTGGCGGTACC
AATTCTTGGCTGGGTCAGCAAGTAGATCTGCAAAGGTCAGACACTTCTCTTCATCCGAAGCTTGGTCTCGGAGAAATGCTGACTTGACCTTGCTGATCCT
AGATCGAGCGCGATCTTCATCCTGATCTTTACCCAAGAATTCCTTCAGATCCGAGATCGCCGAGATCCGAACCCTCTGAATCATGGAAGTTCCATTGGAT
CCGGCGGCTGCGGTGGCCACGGTGACCCGTCCTGAGCGTGGAGCTTCGAGATCGTCGGGATGATAATCCCATGGTGAGGGATGGTGGGATCCGACTGACT
CCATGTCCACATCTTCGTACTTAGGTTCTGCGGGCACTTGAGGTGAATTGATCACCTGTTGTTCTTTGAGGAAGCGACTCATCGCAGCTTGGAAGTAGGA
TTCCAAACTGCTTGTTGTTGGATCTGTCGTAGAGGTGATCGGGATCGTAGCTGCGGTCATCGTTGGTTTTGTCCATGGGTTTTGCGCTGCGATCGTAGCC
ACGGGCATCCATGGCTCGTTTCGCGGACGTGGTTTTGAGATCGGGATCGCCGACGCGGTCGGCTGGTCCCGCGGATCTAGTCGTTTTATATCCGCCACCT
TCGTGCGGGATCCGATCAGGGCCATTCCGGATGGGCCAAGAGGCATACGTCGTGGATCTGTAGAACTGTCTGAGTCTGGCTCCGAAGTAGCTGATGCGTA
GTGCGAAGACCCAGTCTGGCACTCTGCAGTGCTGACCTGAGGCGATGGCTCGGGATCTTGGAT