Description :
From Genome Similarity Track
Location :
Scaffold_74:116148- 124363
Sequence
8215 bases(100 bases per row)
ACGCCTGGAATTAAGAAGTTTTTTTGCGCTACTTACCACCCTCAGACTGAGGGCCTGGTCGAACGGCTCAATGGTACCCTGATTAAAATGCTTAAGATGT
ATGTAAACGAAGCGCAGAACGACTTGAACTTGTATCTACCTATTATGAACTTGTTACCTCGAGGGGTAACTACCAGGGGATTGCATCCACCACTAGTAGC
GAGAAGGGTCCAGACAGTTCTTGCACGGGCAATCGCTGCATCAGGCCGTTTCTCCAAGGGTGATAACCTTTACCAATGCCACATACAGTACTTTCCGGGA
CGTACTCGGCTACATCCATCTTCCAGCCGTGCAAGTAAGCGTGCTTACGTACTCTGTCGAGTGTCTTTAACACTCTAACATGCGCAGCAAGCACAATCTT
ATAGCAGTGATGTAGTACAGCTGAAATGAACGGCAAGGGGATCACGGGTACTTCTAGGGTTGACGCGGGCCCGGCTTGAGTCTTTAAAAGCACGCGACGC
ATGAGTACTCCGCTCTTTACAGAGTAGTTAGGGGGCATCAGTAAGACCTTTGTGCGCAGTTGATCGTCTAGAGCTAGAGCTCTGTCGCTTAGGAATGCTA
CCATAGCCGGAATCCAAGGAGTCGTCTTTTATTCTTCCACAAAGCGTGTTTGTTGGAGTCCGAACACATCAATCCGGGACACCAAGAGTTGATCAGGTGT
TCATTCCTCGTCGGGCACCACTGCACTAGCGTTCTCTAATAAAGATCCCGAGAGAGTAGGTGGTACGGACGAGCCCCGTAACGGATGACGACGGTCCTTT
GACGAAAGGAGATATCCCTTCTATTAGCGTTGTGGAAAGACTCTTTATTGGAGGAAAAGAGACGGTCTTGACTGGGGCTCCCTATCCATTGATCCACATA
ATCGCTAGGCGCAAGAAGAGCCGAGAAGATCCGTTCCTAGTCTTATTGGCCACTTACGAGACCCTACGAAGACCTCGGAGCACTCTGTTATATACTTACG
CGGATCTAATCAAAGTGTTCGAGCAAACCCGTCGTAGGGAGGAGGACCTACCAGAATTACGTCGCAGCGCTCGGTTAAAAGCTGCAAACGCCGCTGTAGA
CGAAGAAGAACTGCTCTTCTAAAAGAGAATAGTTGAAACGGACTGGTCGGTTGAGTTTGAGTAGCTCTCGATCTATTCTTTTCACGGGAAATGTTCAAAG
GAACACTTCTTACGCTGCTCTGTATATTTTGGATTTTGTGTAACGGATTGACTACCCTACTACCTGTCGAGAAGTTAACCCGCGATTTTCAGAAGAGGGC
AAGAGTGATGAAAACAACGAGGTAAATTGTGGGTGAAAGACAAAAAGAAACATTAAAATTTTGGGAGCGATACTACTACATCTACTCCTGTCCGGACGGA
ACCGTTGTGGGCTCTTACGATTCAAGAATTCGAAGGGGCCTTACAACTCAGTCACTCTATCGGATTCCTTCGTCGGTGAGGTGGGAGTGGAGTGTTCTCC
CGGCGAGCTCGACTTCTTCGGTGCCGATGGAGACCGCGACGCAGAGCGTCTTCCTGGGGATACTACCTTCTTCGTCAACGAAGCTTAACGCGACCGCGAA
CGCTTGCATGTATCGTCCCGCGACTCTTTAACTGGGGAGCGAGTCGCTGTTTCGACTTCCGTGTGCTTAATAGAGGTCGATATGTGCCCCTTCGCGTGCG
AATGTGATCTTGTCTTCTCGCGCCGTGACTCACCCTCACCAGCCTTCGTGGTCGAAGGCTTAGCCGATGGCTTCGGACGTAAAGCAGAATGCTCCACAGA
GCGCGACCGACGAGACTTCTTGCGCACAGGTGATCTCGGCTACGACCGCAGAGGTGAAACCGAAGCCGGAGCATCGAACGTCTACGGGTCGACGACGACA
TTGAAGTGTTATACGACTTTCAAGCAGCCGCCCCGACTTACAGGATAACGGTACCCCGTCGCCTTCCCGTCCGGCCTACCTGTCGAGGTGACGAGCGCCG
AAGCTAGAATGGTTAACCTAATGAGATAGCGTAGTTTCTCCGTTCGCCGAGGACGGCAAACACCAACTCGAGGAGGATATCCCCTACCCGGGAACGAGGG
GGCCATTTTAGGCGTCAATCGACTGACAAGGATGACCCGAGGTCTTAAGGCTACTCCTCGTCGTGCCGTCCCGTCAGGTTGGTACCCGCTAGACTCGGCG
GCTCGCGTACCCTCTGTCGAGCCTGTTAGCGTTGCCCTATAGAGTGGACCCGGAACGCTGAGACCCGTTCGACGTGGGCCCCGCGCAATCGGGTCCCTTC
CCAGAGCTTTCTGGTGTCCTGTGAGGGCGGACGTCAGGTGAAGCGAACTCGTCATTTAAGTGTAAGAGAAGCGGTGTTATGTATGCGAGGAAGGGAAGGT
GTTAGCCCTCTCTTTCGGGTACTTATAATGCCCACCTTCTACTCAAGCCAAGTCAATAAAGAAACTTATATTCGTATTAAGTGTTTATATCTACCGTTCC
GGCCACTAAACAAGATCGCACTCCCTGAACAGCCGCGGACTACCCGACCCTTGGAGGTGGAAGTATACGACAGGGTACACACCGGAATGTACCGTCAAAA
AAGAGTGAAACGCCGCTGTACATGATTATGTGACGAAGCTCTGGATGGGCCCAGCCAATTATCTGGTCAGGCTTGGTTATAGGTTCCGACCTTGGTCAGA
AGATATGGAGCTGGAAAAAGATGAGTGCTGTCACTCCATCATCGATAGATTAGGTACTTCGATTTTCCCAAGAAGGTAAGCCCCATAGTGCTTTGCCGGA
CTCGGTAGTCTCGACTCTTTCCCTGCTCTTCCGACGGCCCTTTTCTAGTCACGTCGTCATCCAGGTAAAACGCCAAGCTCACTTGTTTCAACACCTCATC
CACCAGTTAAGTCAAGTCGAGGACGGATAGACTATCTTCTCGCAGCTTAATTGTTTGTAGTCGATGATTTCCGCACTTGTTTCGGGGGTAGGCTGCACGA
AGGTGTGCACTTTCACTAGCTCGTATCCACTGGCTGTTAATCTAATGGAAAGTCGAGCCTTTCCCCAGTATTCCAGTAGCCGCTGCAGCGAAACACAGGC
TTGAGGTGCGAACTACACGCTCTGGTGTATTTTAAGCTTACGTGAAAATTCTTTTTTGGGGTCTCTTGTCTTTAATAACTTGCTCAGGGGGCTTTGAGGT
CACGAGTCGCGTAATTGGGCCTCGTCATGACGTCTTCACGTCGCCAGGACGCAAGTTGAATAGTGAGATTAGCTTACGCCTTTAATATGCAGGGGGAAAG
AGGAGGGGCTAAATATTACCGTGAGCTTTGGTTACGTTATGTACAGCTTCAAAGGTATTAGCGGAAGCTGGAGCTGCGCTGTATGAGGGACTTACCGATA
AATTCAGTGAATATCTCTACTCAATGGCGATGTATCGCTCCTGAATTGACCGAATTCTCTGATTATCATTTAAGCGTTCACCGACTTGCTTCATATTGCA
CGAAAGCACTTCCGCCAATTCTTCATGCTAACGACGATCTGTACGTCAGATCTGTTAATGTAACGATCCCTTAATACGCACGCCCTACGAGCCGAGCATA
CGCTCGACTAGGGAATCTACCAGTGGTTTATGAGTTGCTGTTACCGGGCTGCGTGGGCCACGGTGCGACAATCGCAACCAAACGCCAACGAAGATGACGA
AGAAAACAAACACGAGTGCCAAGAAGTTGCGGTTGCTGAATGATATTTCTACAATTTGATCTTAAGGAATATGCAGTGATTAAGAAATTGTTTTTCTTCG
TGATGCCGTTGTACGGCGTGCATTCGTAGAAGATATGCCCACCATGCTAACAGCAGTAGCAAAATCATGTATGCACTGTTACAACCGAAATTTCTGTGAT
TGGAGCTTTACAGTAACAAGCCAACTGGCGTCCAAATTTAGGTACAGATATAAAATCACCAACTGGGTCAGTTTTACATCAGAAGAGGGATTAGGCCACC
CATTGTTCTTCAAGCAGCATTCACTGGGTGATGTTACCTGCGGCCGCGACAGCCAGCATTCTTCTGTGGTTTGAGATGCTCACAGGATATTGGTTGTAAG
AGGTCAAATTATCTTTTTTGGTACAAGTAGTGCATTCAGTTACATATGGGTACGCATGTATTCGCTCAAAGAGTGAATACCACCGCATTTTTCTGAGACA
TAGTACATAAAACAGACGATAGCAGGTCTACCAAATTACAGAAGACTGAAGAAAACGCGTTCTATCTGCGCGATGTCTTACTAATGAATCACATTAGAAG
TAAATATTTTTTTGCTTAGGACGAGTGCCGTTCCTAGGAAAATTTGAAATAAAATTCAGAGAACATTTTCTTTACGAAAAAAGATAATTATATTGTCCTG
CAAAATAGTCAAGAACAGGCTACAACTTCAACAATGTCATATCTGATGTAGACCGTATACACGGAAATTGTATCGCCGCCGGTATCCAGCATAAATCAAC
AATTGCTTTAGGCACAAATTAAATCCAGCCCCTTTGAGAACTATAAAATAGTTGTTTCAGATAGCAGTCGAGTTTATCTCTTAAAATTTCATCTAGCTTT
CATTGAACCCAAGTAGAACCCGGCTATAGATATTTCAATGATCACACCTCGCTACGCTAACACTACACTAAAAGCGTTAATCATGACCTGGCCGGATTTA
TCGCATCGTAATGGTAACCTCTTGAGGCGCCGTTGGCGAAGCGTGACTGACTTTGTAAGCGGAGAGACGATCCTCCAAACCCCGGAACACTAGAAAGAAG
CTCAGTGATACCGGTAAAATATAAACGATAAGTAATTTGTTCAGTATCACGGTAGGAAATCCTGCTTGAGGCACTTTACCCCAAGGATGCGTCCTCTGAG
GAATTTCAAAATATTGACATTTTTGAGCCATACATTCCGCGATCGACTTTGAGTTTCAGAGCTCACGGAATGATAAGTAACGCGGTGTAGTTACATAAAG
GCTAAGTCCCCTTAGTGCTGGGAATAGCATCTGCGAGAACATCGAATGGACGACAGTCGAGATATGTTGAAATAGATCGACCTCGTAGGAGGTCGGACGG
TCTTTCCTAGCTTTGATTAAACGCGGGGAGGTCGAGAATGCCCGAAAGTCGAACGAATGCCTCTTTCGTCGGTCGCATACACGTTGGAGCAGACAACACA
CATTGCTTCATTTGAGGTGGCATGTCAAGCGATGGCCAAAGCATCAGTGACTGAGTATGTTAAGAAACAAACGTGCATAGTATGCAGTGAGACCCGAAGT
GGCAAATGGGGTTGATAAAATCGCGACCCCGCAGATCCTGAAAGTACGAGAAGCCAAAGCGTCAAGGATTTTCTATCTTACAAATGGTAAGCAAGCATGG
TTCATGTTGAAGCATACCGTAAGTGTAACGGAGTTACATAATGTGGAGCCCACAGGGGTACGGAGAACCCGGAGAGTTAACAAAGGCTCAGTACATAAGT
TGGAGAGCTAACAAGGTCTCTCAGTACCTAGGCCGAAAGCCACACGTTATGCATTTAATTAGGTTTAACTATGCTAGATAGTTACGCAGATACATTTACC
TATAGGCGGCTTGGCCGCAATAATAGTAAATAAAGCAAATCTTGTTTTGAAGCATAAAAGTTAAGGTATTAACTTTGAGTCCTGGTCGTGGGCTGTAAGT
GTCCTTCGGAATGGGGAACTTAGTGTTAGTGACTCTTTGAGTAAAACATCTTCCTCTGACGCTACATCTACGGCAGCTCCGCTACACTAGGTAGCATTTG
TAGCCAACCCCGCTGCTGAGTCGGCTGACCATATCCTCTCCGAGGATCGAACATTCCGTGCTCGCGAATATGCCCCCGGCGCAGCAGGACGCGCTTACTA
AGCTTATGGCCTTGCTTAGCCCTGAGGGTGTGGCTCATCTTGCGTCGCCAGTTCCAGAGGCGGTCACCCTTAGGCTGTAATCGTTCTCACGCTACGAGAA
CGCGCTCTTGGAGCATGTCCAAGAAAAGATGAGCGCCGCAACGGCGGCGGCGTCGATGACGCGTGAAGAGTCTACGAGACTGAAACCGCCCATGGTGAGC
GTGAAAATCATTAAGGGGAAGGATGGAGAGAATTTTCTTCTCTGGACCCGTGAGGTCGCGATGGCCATGCGATCGGCCCTGCTCCAGTATGAGCATCGGC
GCATGGCGCTGGTTATCCTCAGGCTTGGATGTCGGGCTCGCGAATAGGCATTAACGCGCGGCACGTCTGCTAACACTGCATTTTCTACTTGGGAGCAGCT
GAAGCAATAGCGTTCGCGCGTGCTCGCGACGCCTAATCAGGCGTACCGTATCCGGTCGAAGTTTCTTGCCACCCGGCAGGGTAAGAAGGAGTTATCGGAC
CAAATCCAAGAGCCGAGAACCCTCATAGGCGGAATGGCGGCGGACCCCCTTCCGGAACAGGTCAGCGTGACCGTGTTCATGGAGAAACTTTGTGTAAGCG
CAGCCCGAACGGAAGTTTTCCATGTACACCCTAACGCTTTCGAAGAGGCGGTGGATGTGGCATTGAATGCCAAGCACAGCTTCAGGTCGGCTCGACCTGG
TTGGAGCGCTGGTAGCACAAGCTCTTCGAGCGGTCCGGGGATGAGGGACGTCAGCTATGATGAAGGCGAAGACGCGGAGCTTCTTGCTGCTGAGCAGCGC
GCCGGCATCCGCCGATGCTTTATGTGAAATACTTGAGTGTCTATTGCCATCTGCGAAAGCAGCGCGAGGCTCCAGCGATTCATCCTTCCGGGTCATCGCC
GGGAAACGGTAACTCCCAGTAAGCGCGGGGCGGCCTACTGGAGAAGAATTAAGTTCTATTGAACCTCGAGTACGTAGAGGGCAGCGGGGCTCAACCCCGA
AGAGAGCTGAGCTCTGTTACGAGAAGTGTGTGCAAACCGGGCTTGCTGGTTGTTCAAGCGAGCGTGAAGGGCTCTGCAAAGCCACGGAGAGTCTGGAGCC
TTGGGCAACTACACCGTCGCTCCACCCTGAAAGGAAGTCAGCTGTATACTTAGGCACTGGAACTGCCAACGAGAGATACGAACTTTGTCCGTATCGCGAC
GGGGACACTTGTAACTGTGTCGAAGGTCTCTGTCGACCTTGGCGCGAAGCTTGAGAGCTTTCATAGCGTGAAACGCTGCTTGGACTTAGACCTGGATGCG
AGTTATAATCTCATCCTTGACATGACATGGCTGGAAGGCCATGAGCCATGGATCAACTGGAAGTCGAAAACGCAGGGTTCGTTGCACCCTGCTCCTAGTG
GATATTTGGTGAGTCATGAATCCACCTCTTTTATGAAGCACAAGCGCTTTTGGCGTGAGCACGAGGCCGAGGCCGTAGTGCTGGACATTGGTATGTCAGA
AAGCGTAAGCAGCGAGGTTGTCGTTCGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGATGAGCGATGCAGGTCAGGTCAATGACCAACTGCTGGGT
CCTGGTGAAGACGAACGCGGAGTGGCGCGTAATTCACTGAGTGGTACGGATCTGGTCGATGACCTATCGCTGCGTGGCCCGAGGGCGAGTCCAGGCATCG
TGGGCGCGGCCCAGGAGATGCAGGTGAAGTGACGCCTAGTTCAATGTGTGAGGATTAAGGCCCTCTTGGCTCTCAGCTGAGTGTCTTGCGAGACACTGTC
TCCACTTCGAGGAGTGATGCTGCTACTGCACCCGGTCGTGGTGATAGCGATATCGCCACACCGCCCTCATCCGGCCGGCTCCGGTCGCGGAGGGAGAGGT
GAAGAAGACGCAGGACGTCTGTGACGTTTTCGATTTCGGACGCGATATCCAACGTGACAAGCGGTGAGGGCCCACGGGATTGCTGGGAACAGCTGTACAC
ACTCGTGAGCGGGGTGACGGGGGAGGACGAAGGCGACATTAGCCTTGACTCTCCGCCCGTTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCC
GAGTTTAACGAAGCCTTGAAGGCAGGCAAGCTAGCCGAGGCGGTCCTGCTGAGCTAAGGAGGAGCTGAACGCCTCATGAGTCGTGGACGACGCGGTCCAA
GAGGGCGCGATGAAGGCGCTGAGTGCATGAACTAAATCCGCGATCCTTCGGATCCCTTCTACCATGTGATGAAGGAGTAGGGAGACGTTGTCTCGAAAGA
CCCACCGACAGGCCT