Description :
From Genome Similarity Track
Location :
Scaffold_104:11612- 14332
Transcript NameFunction/comments
Hyaar_Emoy2809563hypothetical protein

Sequence
2720 bases(100 bases per row)
CAGACGCAGGCGTCTTCAGGTCCACGAGAGAGAGATCATGATATGGCTTAAGCAAGCCAACGTAAAACACTGGGTGTCTGAGCAACTTGCGCAGAATATT
GAGTGTATAGGCAATGCCCTTCTTCGCTATGACCGCGAATATCCCGATGAAGCGTGGGTGCAACTTTGTCTTGAAAACGGCAGACACTACATTTGTAGGT
AGGTTTTAGCATTTAGTAAGACTTGGTCTCGAACTGCATAAGTATCAAAATATTCTCTGCCTTTAGCATCAGCTTGATCTTTTTGTTTATCCTGGCTATC
AGCCATTGCATCACGCACGCGTCGTAAGACACTAAAGCGTGTCACGAGAAACTCGCTTACTTGTTTCTGCATCGTGGTAGGGCTGATTTCAGCAAGCGTG
TCAGCAGACTCTCCCGCCAAACCCAGAACCACGTAGTGGTAGCGTGAGCGGAACGCGGGGGTGCGTGGGCCTATCAACATAGAAGATAGTAAAGTCGGTC
GAGACATGTACAGCGTTTTTCAATGCAAATTCGATGACAAGGAGCATTGAGCTCCGTCTTAGGCGACCCAGCACAAACACTACGAAGAACATCGCCAATG
ACGCGATTGACTCGCTCAGTTTGACCATCGGTCTGCGGATGGTCCGCTGTGGACATGTCCAATTGGGTGCTAAGCACCTTGAAGATGGAAGTCCATAACG
TTCCAGTGAAGCGAGGGTCGCGATCAGAGATGCTTGCCAGCAGCAAACCGTGTTGACAAACGCACGACCGATAAACATCATAGCTGTATCTTTGCCATCG
ATCGAATCCGGCACTGCCCCATAAGTGAGCCATTTTGCATAAACGGTCAACAAAGACCACAATTCACGTATTGCGGTCCCAGTCTTTGGGAAGACCAAAC
ACAAATCCACAGTGATGGACTTCCAACACCCCGTGGGTACAGGTAAACTGGCGAGTGGCGTAGCCGAATGTGCCGAGTGTTTGACTCGCTGGAACGTTTC
GCATGTACGCACGTATGAGCTCATCCATTTGTAGAGTTTGGGCCAACAGTAGTGTTGACCCACAGAGACATAAGTCTTTTCCCGGCCCAAATGCTCACTG
AGGGCAGTGTCATGGGCCTCATAGAGGATTCGATACTTAGATCCTCATTTTGAGGCACAACAATGCGAGCGGTATCCGCTACATCTGTGCGATAGCACAA
GTGAACGTTATCGATGGAATATCGATGTAGGCTGGCCCGCAAGCGTGCCGATAACTGAATGGCCGAGTCTTTGTATTCCTTACTCCCAAGGGCACGAAAC
AATGCCACATATTGAGGATCCCGTGGATATGCCACACGAATTAACTTCTGAAAAGGAGACGACAAAGTCGTGACATGAGCAAGCTCATCATCAGGTCAGC
GAGAGAGGGCAACTGCCAACACATTTTATTTGCCTGGCTTATACTTCACCTCGAAGTTATATTTCTCAAACAAGAAAATCCATTGAGCCATTCTCTGAGA
GAGGTGAGGCGACTGTGTCACCATGCGTAATGACGCATGGTCCGTGTAGACAACGAATATCTTGAGGCCAAGCGAGGAACTCTAAGTTTGACGAGTGCAT
ACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTTTCAGCAGCTTTCAGCTGACGAGGTTCAAATGCGATAACTCGCTCGCGGCCTGCAGC
ATCGGTTTTGTAACTGTGCGCTGCCTATAGCAAGATCGGATGCATCGCAGACAACACTTAAAGGATACTCAGAATTTGGCAACGCCAAAATGGGAGCATG
GAGGAGAATCTCCTTGATTACCCGAAATGCGTCGGCATGGGTGTTGCCCCGGCGACAAGCTGTGTCGTACTTAAGGAAATCAGTTAATGGCCGATCCATA
TCAGCGTAATTTTACTGTATTTGTGACAGTAATTGGTAAGGCCAAGCCACTTACGCAAGTCCTTTTTGATTCTTAGGAATCGGCCAGTCCACTATAGCTT
TGACCTTAGCGGGATCCGCTCTAAGGCCGCGCTTACCAATGAAACAGTCCAAAAATGGGATCTCATCCGCACCAAAAATGCATTTAGACGCGTTGGCGTA
CAATTTATTAGTGCGCATGCACTCGAGCACGGCTCAAAAATGACCGATGTGGTTGTCAACATCTGACCGACCCTGTTCGGCACGACTATGGACAAAAATG
TCATCAAAGTACGTCTGTGTGTAATCCCGATGTGGGCGGAAAAGTTGCGTCACCAGAAGATTAAATGTTGCCGGAGCATTAGACAGCTCTTGGGGCATCA
CCAGCCAACACCATAGCATACCACTCGCAGTGCTCACTGCCGTAAGAGGAATATCACTCGCTTGCATGAGCAATTGATATTATCCATCGACCAAGTCGTG
TGCGCTATACATAGTACAACCAACCATGTTGTTTTAAAAAATATCCTTTCGAGGAATGGGTGTCTGTGCCGGAATAGTACCCGCATTCAGCTTATTATAA
GCATGCTCAATGCGCCACTTGTCGTTCGGCTTTTTGACACAAAATGTCGGTGTCGAATGTGGAGATTTACTATCACGTACCGTTCCTGCCTAGTGCTTGG
AACGGAAGAAGTCATCAATGACATCACATTTCTCCTTAGGCAAGGGCCACTGTCGTGTGACACAGTATTTATTCCCCGGAACTAAGTCAATTTCATGACG
GACACCTCTATCTGGATGTA