Description :
From Genome Similarity Track
Location :
Scaffold_136:11612- 25132
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_136-fgenesh-gene-0.6Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_136-fgenesh-gene-0.0Vacuolar protein sorting-associating protein
Pytiw_DAOMBR242034maker-piw_contig_136-fgenesh-gene-0.7KIAA1841
Pytiw_DAOMBR242034maker-piw_contig_136-fgenesh-gene-0.1Importin alpha-2 subunit
Pytiw_DAOMBR242034maker-piw_contig_136-snap-gene-0.13Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_136-snap-gene-0.25Transcription factor

Sequence
13520 bases(100 bases per row)
GCTTCCTGATCAGCACCTCGACGCTTGTGAGCTGCTGCGCTCGAGTAGGAGAACTGATCACGACAGAAGGAATTGGTGTGAGCGGATGCACTCTGCTGTT
GTCATCTAGATCAATAAAACAAGAGCCAAAATGTAATGTCAGTTGTTACGAAATGCATGCGTGGTTTTACTTCCATCATCACAAATCCTCCGCTACGTAC
CACGCACCGCGATACGAGCAAACTGATAGTCGACGTACCCCAGCGTCTGGGTCAGCTTCGCTTGTTGCGCGAAGAGTCCATCCGACGTTGTTGCAGTCGC
CTTCGCAGAAACAAAGCGTATTCAGTCAGTAAAACTAGAGTAAAAAAGCAAAGACATCCAGTGAAGTACGTACAGATCCCAAGTCGTTCATAAAGAAGAT
GATTTCCGCATCCGCCATCGCTTTATCCACCACGTGCTGTCGTAGCACCTCATTTCCTTCTCCGAGCAAACCTGGATAATATGGAGATAGCAACATGGTG
TTGAGTGAGTTTTCCAACAAACAATATCACAATTTACAGAATGATGTGGAAACTTACGCTTCGCTAATGGCTTCATCAGTTCTTCGCGTACGTCTGGCAG
GCGCTTAAACATCGCCAGCCCTCGTGCTGCAGCCATGAGAACCATCATCAACTCGCACTTGTTGAGCGTCTTCATGCCACCGTTGTCCAGAAGCGACAAG
ATAACTGTACCAGCATCCACACAAAATACAACCAGAGAATCAGTACACGTCCTTCCACTTCTCCATGGCGCCGCCAGCCTCGTACACTCGAACTTGATGG
ACTTTTTGCCCTCGACGACGAGCGCGAGGCCGCTGAAGAAGTCCACGACCGCAAGCTTTCGCTTCTGTCTGCGGTCGAGCGTGGTGAAGATCGCCAACAG
TTGCGTCTTGTCAGTACCCGTCGCGGTGCAGATCGGCGCGAGGATCGTCTGGAACGCAGGAAACGCCAGGAAGAACTGGCTCTGCGGATCCGTGCGGCCG
TGGCGATGCACCTCCTGCTGGAAGCGCAGGTGCAAGTGCTCGAGCTCCGCCCAGTTCTGCGGCAGGATGCGCGCCACCTCTGCGCGCGCGCCTCCCTTCG
AGTGCTTGCTTCCCATAGAGTGCGGAAGTGGTGTTGCGATGTTGAAGTAGCTCTACCCTTTCGGACAAAACAAAAGTAATTGTGCTGTATAGTACGTATG
AAGAGTGATTGTCGATCGTAGAGGAATGATGTTTTATTGTGTACAGTGAGAGACGAATCAGAAGAACAAACAGACGGGTTGACGAACAGCATACTGAAAC
CAAGTTTGCAGTCTATTTTAAGAGGAAGACCGTGAATGTCGAATTAGAAAAGTAGCAACTTATTTTGTCCTGACAGGACAATTTAACCTGCCCAAATCTA
GGTGCAGAGAAAGAAAGAGTCACACGTGCTCTTATCACGAGAAGCGCAGCTCACGAGAGCACGAGGAGCGCAGAAGCCAAGTGAGAAGACCGAACGCAGG
CGCGTGTGTGAGTGTGGGAGATGGAGAACAAGTTCATTCCGCAGGCGATCGAGATCGTGACGCTCGCGATCAACGAGGACAACAGCAAGAATTACGAGGA
GGCCTTCCGGCTCTACAAGAAGGCGCTCGAGCACTTCATGGTCGGCGTCAAGTGTACGTGTGTCTGCCTTCCTCCCTGTGTGCATGCGTCCGTGATGACG
TAGTCTGATCGTGTCATATACTATGGCTGCTCGCGATGCTGCAGATGAGAAGAACCCGACGTCCAAGGAGATCATCATGAAGCGCGTGGAGGGCTACATG
ACGCGCGCCGAGCAGCTACGCACGATGCTGTCTAAGAACGACGTGGCGAAAACAGTCACTGCTGGCGGCACGGCCGAGCTAGAGAAGTACGCTATCTGCG
CCCTTTTTCTTAGCTGATACTCATGATCTTGCACTGTGTGCTGACTGTTGGTGTGCTGATAATGGCAGGGGAGACAAAAGCGACGAAGACGAGAATGACG
CAGAGACCACAAAGCTTCGCGGATCCCTTGCATGTGCGTATTACTATATGTGTGTTGCCCTCACAGCCTGTTTATTGGCGCTCACACATGTGCTTGTATT
TGCAGCTGCTGTTGTGTCAGAGAAGCCAAACGTGAAATGGGATGACGTTGCCGGTCTTGAAGCTGCGAAGGACGCCTTAAAGGAAGCTGTCATTCTGCCA
GCTCGATTCCCTCAGTTATTCACGGGCAAGCGACGACCGTGGAAGGGGATTCTTCTGTATGGGGTGAGCCAAACAGCTTTCCAATACATGGCTGCAATTG
TAATGGCATCCCGGTGTGAGGTCACTAACAAAGACTACCTGTGTTACTATTGCTAGCCTCCTGGTACTGGCAAGTCGTACCTCGCGAAAGCTGTTGCAAC
CGAGGCGGACTCGACGTTCTTTGCCGTATCGTCATCGAGCCTCGTGTCCAAGTGGCAGGGAGAAAGTGAAAAGTACGTTGCTTCATGCACGCAGGTCTTT
GAATATTGAGAAGGAAAAAATGCTGACGTTGTGCTGCTGATTATCTGTGAAACTAGGCTCGTCAAGAATCTCTTTGACATGGCCCGCGAGAAGAGGCCGT
CGATCATTTTCATCGATGAGATCGATTCGCTGTGCTCGAACCGATCGGAGGGCGAGAGCGACTCGACGAGAAGAATAAAGACCGAGTTCCTGGTGCAGAT
GCAGGGCGTCGGCAACTCCCATGACGGCATTCTCGTCCTTGGAGCGACGAATGTGCCGTGGGAGCTTGACCCAGCGATGCGAAGACGGTATGAGATCCTC
GTTCATGCTCTTATGATTCGCTCTGAATGGATCATAGTCACCTCACGTGTATATGTGTGCGTGTTGTGCAGCTTTGAGAAGCGCATTTACATCCCACTCC
CAGAGACGGATGCTCGCAAGATCATGCTCAACATCCACTTGGGCGACACTCCGCACGGACTCACGGACGCGAACTTTACCACCATTGCTGAACAGACTGA
AGGGTACGTTCGGTTTGCTTGCGGGTGCACGGTCTAGTTTGTACCAAGTTGTGATTGTGGCTCAATATCCTGACTGCAGGTGCTCTGGTTCCGATATCTC
CGTGTTGGTGCGCGAGGCTCTGATGGAGCCGCTTCGAAAGTGCCAGCAGGCGCAGTTTTTCACTCGGGTAAATGCATTCTACTGACCACTGTTTGAATTA
TCCGCGTCCAGCTAAACTGATGTTGTATTATTGTCACATGCAGTGCGACGACAAGGCGGATCTGAACAGAAGCGGGCAGTACCTGACTCCGTGTGAGGAC
GATCCTGCGTGCGCATACTGCCACATGAAACTCTCGTCGTGCCCGAAGAATTGTCCGGACTGCAAAGCGCCGTGCCGTCGATGTGGAGCGCTTCGCATGC
GCCTCTACGATCTGCCCGACCGTGGCTTCTCGGATGAAAAGCTGCGACCCCCGATGATCGCGATGGTATGAGTGTGGTTTTTTTGTTATTGGATATTCTG
GGACGAAAACCATTATCTAACATTGTTTTTGCTACCTAGAACGACTTTAAAAAGTCGATGGAGCACTCTCTCTCGAGTGTGGCCCCCGATGAGTTGAAAC
GCTTTGTGAAGTGGACCTCTGAGTTTGGTCAGGAAGGCTAGTGAGCGAGTGAGTGTGAATCAAGGCAAGTGGCTGCTGCTGCATACGATTTTTTACTCTT
CATAAATGAACTGCATCGTGCATTTTCAATGGAACGTCATTCTGTTCTTCATTGTACCAGGTTGTCTATTGTTCGTCTATCTATGCTGTCTTCTGGATAT
CCTCTCATAGCCAAAAGCTCACGCGCTCGAAGCAGAATCTCCAGACTCGAGCTCCAACGCGAGGCTCTTGAGCTCATCGAGCGGGAACTGGTACATTTCA
TTGCAGAAATGGCATGTGAGGTCCACTCCCTTGGCGTCCGAGTCCTGGATCACGCTGCTCAATTCGTTCGCTCCCAGCTCCTTCAGTCGGCCGGCAAAGC
CCTGCTTGGAGCATCGGCAGAAGAAGTCAAGCGGGATCTTCTTGCAGCTCTTCTCCGTGAGGTCTGCATTCGGGATTAGCTTGTTCAGATACGCCAGCAA
GTCATTGTTCTCTGTCACGGCGCTCGCCAGCAACGGGTTCTCGTCGAAGCGCAGGTCGTCGAGCTCATAGAACTGTCCGTGTGGCGCCGAGTCGGGCATT
TTCTGGATCGTCACGCCACAGCAGTGCGCGTGGTCGTCACTCACGTCGCTGCTGATGCGCACAGCGGTCGGAACTTGCTCAGATATGTCGTAGAAGGTTT
GGAAGTCCGCTTCCGCGATGCCCGTGGCGCGGATCGTGGTCTCGTACGGCTTTGCCGCCCCGAACAGGATCTTGGAGACCTGCATTTGCCCGAAATCTGT
GCGTCCAGAAGGCGAGAGCATGTACATGATAAGTACGTATGTGGCTTTATAGCGAGCAGCAACATTTTGATGGAGCTCACTCACCATCGCTGATGTCGCC
GAGTCCGTTCAGGTTGGCGTTCGCTAGAATCGCTTTGCCTCGCACCTGGTGGCGCCAAATTAACCGTGACAACAGCATCAGCTCTGCCCACAACGTCCAG
TACCGTCATTAGACCACAATATGACTAGTCTACTCACCTCTCCGACGGCCATGGCCTCGACGTACAGCTCCCGGATCGACGGCGAGCGCAGTAGCACCTT
GACGCGCTCGTCGCCCTTGTAGAACGAGCTGAGCATCGCCGTGCCGGCCATGTACTCGCCCCAGAGCTGCGTGGCGCGTGACGCCAGCGGCTGCTCCCAG
CGACGAGCAGCCTCCTTGACCGACGCGCGCGCCACGACGGCCGACACGCGCAGGTTGCCCACGTGCGTGCGGAACACGACGTCTCGGAGCTGCCGGTTCC
ACATCCTTGGTGCTCTTTTTGATTGTACTTGCCTGTCAATCAAATCGTCTCAATACCGGTAGTGATACCGGTATTTTAAGTCAAATGTCATGCAAATCCT
CACGGAATACCGGTAAAGAGATCAGTATTTCAATATGCGTGTCATCACATTACCAGTATGTTACCGCCGGTGATACCGGTATTTCAAAATTTGAAATTGA
TGATAGAAAACTCGTTTCGTTTTTCAGGTTGTGAGATTCTTCCGCATCTGCACCAAACGACGCGCAAGCAGCTGGTGGCGCATGCGGTCCTTCTCCTGGA
GCTGCAGTGCGTGCCACTGGCGGCGTCTGCGCGGCGAGTTCGGGTCGCTGGTACCCGTGGCAGCACCAGTAGCCGCCGCTAAGCTCGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTTGTTATTGCGGTAGTCGCTGGGCGC
TTGGTGACTGACACGGCAGGCGGCTGCGTGAGCTGTTCGCCATGCAAGAGCTCCTGCAATGCGACGGTCTGCAACGATGGTGACCATGCAGCAGTGGTGC
CAGTTGCATTCGCTGCTGCTGGAGCTTGAGTGTGCGCTGCTTTCTCACAGCTACGGATCAGATCCCAAAGCATCGGGATCTTCGTCACAGCCTCGAGCCC
TTGCGCTGCGATGGTGTCCTGCTCGCCACTGAACACAGGCACGTGGTCCTTTCTGTTGCAGCCACTGACAGCGAGTTCGTTGCTGTCAAACAACTTGACA
CTGCAGCACGAGAGCTTGGCGTCCGAGCCAGATCCGACCACTTGGCCGTGATGATACGCGCACTGGTGGAGCTCCAGGAAGGGGTAGTGGCGCTTGCACG
TGCCGCAGAAGAAGTAGTTCGTGGACGCCCAAACGTACCAGTACGAAGCGCTCCACGTGACATGCTTTTCTGAAGCCAGGTCGCGGAGGAACTCCTCCAC
TTTCCAGTCTGCCGCCATCTTGGACTGGTGATGCGCCACGAGCTCGCCATGCACGCCGATCTGGTGTTTCCCCCGTGGACAGCTCAGCAATCCCACACTT
TCCTTCAAATAGACGCTCTCGCAGTTCTCACAGCACTCTATCTCTCGCCCCACATCTTGCAGGCGCTTCACATACGCCTCGAGCTTCTTGCGTTGCAATT
TCGAGAGGATTTTGTCCTTTGGGTCGTGCAGCACTTGGAGCTCTTCGGCGCTGCACCGGTCCGCGATCTTCGCGACCGCCGCGTCCGAGAGACAGCTGAA
GTCCACGCGCAGTTGCAGGAACTGCTGCATGCGTGTGGTGATGAAGCGGATGCACTCGTCCACGAGCGCCTCCATCTGCAGGAACTCGGACGACACGAGG
ATGGACGCGATGTTGTCGAGCGCAATGCGCGGCTTCCATTCGGCCTCGCTCTGCTGCATGTACTGCACGAGCCACTCGAAGACCTCGACGTCGCAGTGCA
CCGAGATGTCGATCTCGTCGTGCTCGTTGGACTGGTTCAGGTACGCCTGGAAGTACTTCATCTTGGCCAGCAGCAGCGCGCGGTCGCACACAAAGTCCTT
GGCGCTCTTGCGGTACTCGTCGAAGACGTGGATGAGCACGTTGCGGCCTGTGTGTGCGGGTGATGGCGGTGAGGATGCGGGGCGCGCGAGGCGAGCACGT
GGGCTCAGCATTGCTGCTTGGAGGAATGCTAGATGGTCCGACCTGTCACTCAAACTTGATTTTAAAATCGGATGTTTATCCTACTTTAATGTAAAACATT
CGGCTCAAACTTGATTAAAGTATATTTATGCTTTAATCAAGTTTGAGCGACAGTTTTTGGGTTACGCTGTTAAGATAGGTCAAAGGTCCTATTTCAATGC
GATTCATTTGTGCAGCAACGAATTGATCGCTTTCAGGAGGGGTTGTGATCTGGTGGCCAGCTCTTCCCAAATCGAAGAAGGAAAATCGAGAAGAAGCGCG
AAGGCCCGCTTCACTCGCTCGCTCGCCTCCGTCGCCCCGTTCCCCCACCGCCGCTCTCCGCCCCCACGCCCCCGCAGCAGCAGCAAGAGCACGAGCAGCA
TGTCGTTCCCTTCTGGCAAGGCGCCTGAGCGCAAGAGCAACTTCAAGAAGACCCTCGATGCCGAGGAGATCCGTCGCCGCCGCTCCGAGACCACGGTGCA
GATCCGCAAGACCATCAAGGAGGACCGCATGAACCAGCGTCGTCGTATGGTGTGTTCTTCATATGTGTACTGTGGACAACATGTTGTCTTAAGTGGCGCT
GACGAATCGCTCTCTATGTGTTTGTGCTGTGTAGGGTGCGGACACTGCGGCTGAAGAGGAGAACTCGATGGGCGGCGACGCCGCTGGCGACCTCACTCTC
GCCCAACGTGTACGTTTTTCTTTCTTTGTCCCAGTGCATAACCCCCTCACCTGATGGATGGAGACGAGAGGCTGACGGACAGTGTTGTGTGTTTTCGCTG
TTCTTTTTTGTACCCAATAGCTTTCGCAGCTCCCAGCAATGGTACAGGGCGCGCACTCGGCGGACCCGGAGACCCAGCTTGACGCGGTCACCAAGTTTCG
CAAGCTACTTTCGATCGGTACGACCATGCTGCCCTGTGTACCCAACTTGTTTGGACGACACACCTGGTGCTACATGTCTCTTCTTACTGACATGAGCTCC
TCTTTTTGTATGCTTTAGAGCGCAACCCTCCGATCAAGGAAGTGATTGAGACGGGCGTCGTGCCTCTCTTCGTGACGTTCCTGCAGCGCGAGGACTTCCC
AACTCTCCAGTTCGAGGCCGCGTGGGCGCTGACGAACATCGCATCCGGCACGTCGTCGGACACTGAAGTGGTGATCAACCACGGCGCGGTGCCGATCTTT
GTCCAGCTGCTGCTGTCCACGAACGACGATGTCCGCGAGCAGGCCGTGTGGGCGCTCGGTAACATTGCCGGTGACTCGATCGAATGCAGAGACATGGTGC
TTCGCTGCGGTGCGCTGCGCCCGTTGATGCAGCAGCTGTCGCAGAACTCGAAGCCAACGATGCTCCGTAACGCCACGTGGACGCTGTCGAACTTCTGCCG
TGGCAAGCCACAGCCGCAGTTTGAGCTTGTGCAGCCTGCGCTGCCAACTCTGGGCCAGCTCATCTTCACGCAGGACGAAGAAGTACTGACTGACGCGTGC
TGGGCGTTGTCGTACTTGTCGGATGGCTCGAACGAAAAGATTCAGGCTGTGATCGAGGCTGGCGTGTGCCGTCGTATTGTGGAGCTCCTGATGCACCCTT
CGCCGTCGGTGCAGACGCCGGCGCTGCGCACCGTGGGCAACATTGTCNNNNNNNNNNGGGCAACGACCTCCAGACGCAGGTGATTATCAACCTTCAGGCG
CTGCCGTGCCTGCGCTCGCTGCTCGACAGCCCAAAGAAGGGCATCCGAAAGGAAGCGTGCTGGACGCTTTCGAACATCACTGCCGGCAGCCAGGAACAGA
TCCAGTCGATCATCGACGTGGACATCTTCGGGACGCTGATCAGCTTCCTGTCGACGGCGGAGTTCGACATTCGTAAGGAGGCGGCGTGGGCGGTCTCCAA
CGCCACGTCGGGCGGCTCGGCGGAGCAGATCATGCACTTAGTGAACCTTGGCTGCATCAAGCCACTGTGCGACCTGCTCGAGGTCAAGGACGCGAAGGTC
GTGATCGTCGCGCTCGAAGGTCTGGAAAACATTCTGCGCATCGGCGAGCAGCAGAAGACGGGCGAGCTCAACGACATCGCGACGTTGATCGACGAGTCGG
ACGGCGTGAACAAGATCCAGGCGCTGCAGTACCACGCGAACGAAGACATCTACGTCAAGTCGATGAAGATCGTGGAGCTCTACTTCCAGGGCGAAGAGGA
CGCTGAGGATAGCTTAGTTCCAGACACGGACGCGTCGGGCCAGTTCCAGTTCGGTGCGAGCTCTGCGCAGCCAAACGTGTTCCAGTTCGGCAACTAGACG
GAAGTCGTCGATCGAGTCCGCGCGCCAACCAGTCAGTCAACCCAGTCAACCTCCGTATAATCACGAGCTCCGTGGCGCCTTCAAGAACTTTTAATGAAGA
TCCAGGCGCTCGCTCTCCTGTATGAATTGGCTGACGGCGGACGAATGTGGCGGACGACGAGATTCAGTTGCTGCGCAAAAGAGAGACTGGGAGAGAGGCG
TTGAGTGAAGTGCCTTGCGCTCTCGCTCTCTCGTCTACACGGAAGGAAGAGAAAAGGAACAAGCAGAGTGACGATGAGCTAAACACGCAAACATCAAAAT
ATATTTTTCGCTGTGAACCAATTTCAATTACATGTCATGTGAGCTCCTCGACCGGTTGAGTGAGCTCTTCAACTCTTTGGGCCTCAGAAACTGGTTTTCG
TACTTAAACGGAAAGGTATTTCATTGCCAAGCCTAATCGATAAACCACATAATCATAATAATGGGCAACGCGCTGAGCTGCCTCGAGCAGTGCCGCTCGC
ATCAGGAGAACAACCAGCGGCTCCTCTTCCTTCAAAAAGGTGCGCATGCTGTTGCTTCTGTCGCTATCGTTTTAACACATCAAGCGGCTGGCTGGCGTGC
TCACTCACTCGTTCATGACGACGTGCAGGCGCCGTGTTCAAGCGGAAGAAGTACGTGTTGGGGCTCAACTCTGGCTCGGAGCAGATCCACATGAAGCTCA
GCTCGGACGAGCAGACGTGAGTCTTGTGTGTCATCATTAGCAGCTGCAGCACAGCGTGCTGAACTGCTGAGTGGTCGCACGTACAGACAATGTCTGACAG
ACATGCTCACTCGCTCTCTTTTGTGTATTTATGGCCTGCAGACTGCTCTGGAGACCGCACGAGTCGCAGAAAGAGCTCACGCGGATCGACCTCAACGAGG
TCAACCTCATCAAGACACAAGGTGATAGCATCTGCCACTTGCACACAAGCACCAAGCAGTTGCATGTGGTCGCTGACATGAACGTTTGTATTTATTATCA
GGCTCCGTTGGCTTCAGCGTCGTCTCACAGAAAGGAGACACGCTGCTGGACCTGGAGGCGGAGAACGAGGAGGTCCGCAACAACTGGGTACGCAGTGGCG
TGTATAGCACCCTTGGGGGCCCCATGACAGCTTAACATTCACCCATTTGTAACATCTTTCTGCAGGTAACAAATCTCCAGTTGCTGTGTGAAGACAGCGG
CGACGTGGACAATGGGGACGCAGCAGCCTCCGCCGCGTCGCCCGACGCCGCGTCCAAATTCCGCAAGATGGTCGAAGAGAAGGCCAAGAAGCAAGCGTAC
TGGGCCAAGCGCACACAGGAGCTGGAGGACCGCAAGCGCAAGGCCGAGGAGAAGAAGAAGCAGTTCGCCGGCTCGGGGCTCAAGTACACGGCCATCGCGC
TCGCGAATCGCCCCTGAGGCCATTGTGCTGTAAGACATATATGTCCAACTTTGTACAGAGGCTATGTGGAGATCTGGCCAAGGCTTCCATGGGGCTAATG
CGCCGCACGACCTCCTGTGCGTGTGATAAGGCTTTCAGGCTTTCAGATCGAGCAACAGCTGCTTGCGATTGGTCAAAATTGATGTGCACTTCTGAAATTC
ATTCAAAACGAGCAATGGACGCACTCGAGACGCAGCGCTTCGCAGATGAGTTCCGCCACGTCACACTCGCGCACGAGCAGCTGGTGCGTGTGTTCCCACT
CACTATGAGCTGTGGCGTCTGTGTGAATTCACTGAGCCTTTGTGTGGCTGGTTCTCGTGTCTTTAGGTACTCTGCGTGTGTGGATGCGGAGGAGATGACG
CGATGCTCGTTGCCGACGCGCTCAAGAAGATCGTGCGCATCAAGCTCCAGATGAACGCACAGGTGCGTGTGTTGCTGATAATTGGCAAACTGTATGGCCA
AGTATCATAACGACATGACCGTTTGTGTGTCTCTATAGCACCAGATCAGCATTGTGCGCTTCCACGACTCGCAACTGACAGTTCTCCAGGAGGTATGCAA
TCTGACCACTGCCACTTGCTGTGGATGGACAGATGCACGAGCTAATGCTTAGTGCCATGCATGCATACAGCTTACTAGGGACGCTGGCCACTTGAGCGCC
GCGCTGGATCAAACTGCGGCGCTCTCCAATAGCGAAGAGCGCTCTGAGGCGAACAGCATGGACGACTTGCTACGAGACGCGGGGCGACATTTTTCCAGTC
ACGACAAGTCAAACAGTGCGCAGTGTGTATTCCGTCTCGTCGTTCTCTGCAGACACGACCTGAAGGTTTGATTTTTCTCTCGAGAGACTCTGTATACAAT
ACGTGGGCTCGATAGTAACGATCTCATCACGTGTGTATTTCAGTCCCCACCGATGAGCTTTACACTGAGCGAGTCGTCGGCAGCGTTCCTCTCGCACCCG
AAGTTCCACTTGGACGTCATCTACTGGCACACGGACATATCCAGCGAACAAGCCCAGGTAAGGCGAGAGACTTTGCATAGTGTGTCACCAGTGCCGCGCT
CTTTGGTCACCACTGTTATCCCACGTCGTCGCAGAGCACTTTCGACCAGCTGTGCGCATTCGAGAACGCGAACCCGTTTGCGAAGGCGTACTTTCTCGAG
GTCAGCGGATCGATCGAGAGGCTCTTCCAGGTATGAAGCACCCTCTCATGCTCGATTGTTTGCCAACGCTTAGGCTGACTCTGGTGATCCGTTGTAGGCG
CTTGCGCTCGTCCTTTCACACCCGGCGCATCGACTGGACCAAGTTGCAGCGGAAGGCCTGCTCGAATCATCATCTCTTGCTCACTGAGTTCGTCTTCATA
GTAACACGATCCTCATACAAGTGGTCATCCGCTCGCACCACAACTCCAGCTTCACTCGAAAGCGGTCCCGACGACTGAGATTGTACACGTTGCTTAAATA
GATGACAGCGATTGTCAAACGTTTGGTGCGGAACTAAACTAAAGTGCTTGGTGTGCGTCTCTACGGGCAATCGGCAAAAAAATCCGAGATGCCCTCGTTC
TCGTCGAGGTTGAAACAAAAATCCGGATCCATCTACAAGTTTAGCAGCAGAGAAACCAATGTGAGAACAGCGACACGTCAGCAAGCAGCAGTCGGGTTCT
GCTTGACTACCTTTAAGGGAGCCAGCTTGAAGAGCCCGCTATCGGAATCATAGGATCGCTGTGAAAATCAAAGCAGAATGTCAGTTTCGGAAGCACGCAG
GCATGATGCCCGAGCAAACACGAACGCCATCCCTCACCTGATCCAGTGCTGCAGCTAGAGGAGGAGTTTCAACTGGTGATGCCGCAGCAGCAGTCTCAAT
CTCAGCAGTTGAAGCAGGAAGTGCTGGTTCTTTCTCTTCTTCTTCTTCCTCTTCTGCAAGCTGACGAACTAAATAGACATCCACTGGACCATCTACATCC
GCATTTTCACATCGACAATCATCAGTGCTAACCACAAACGTCATTAAGCGCAACGCAAAGACGCCTGTCACTCTCACCTGTAGACTTCAAGAAGATCTGG
AATCTCCGCTTGCCGGTCTCCATGCCTTCGTCCGGGTCGGGGACCTCCAGCGTAGTGCCAGGGGGTGCTTTGATCGCCATCACGCTCTGGTCCTTAAAGC
TCTCCAGACTCCGCATATCCTCATGTGTGATGTACGAGAGGTTCTCAAAAGTGCCCTTGTCGAACGCTTCTTCGTCATACAGCCGCCGGATGCTCTGCGT
CACCATCTTGATGTGTTGCTCGTACTTCTTCTCCTCCTGCATTAAGTCGGAAATGCTCTGAAGCAGCTGCTCCATGTCTTGGTAGTTGTCTGCCATGCCA
AGTGATCCGCTCGCGCCCCTGTACGTGAAGCACACGTGTAGCAATAGACAAGTACTGAGTAAGCAACCGTTTTTCGCACACAACGAACACAAATGTGCTC
AAACGCACAGAGCCAGCTGGTGTACGTACTTCCAGTGGATGTTGTTCTTCGAGGTCTTTTCAATGAGACCAATGCCTTCCAGCACATTCGTGATGTCGTA
GATCCGTCGTTTCTACAAAGCGCGGCGCGTGAGCATCAACTGTGAGTCCAATTTATCCACATGCACAAGAAGCTGCCCGCGGGTTTTGTTACCCACCTGC
ACGCCCAAGGAGACCGCCGCGCTGTTGAGATCGAGATCGCCCGTCGGGGAGGACTGGATCAGGTCCACGAACTTTTTGGTCAGCAATCCGAGCGAGCTGT
CGTATCTGCTGGCAGGCGACGGCTTCAAAGCGCTGCCAGCTGTTCGTAGTACGCCACACGTACACAGCAACACGCCGCAGACAACACAGGGTCAGAAACC
GATCCAGACCGAATCAACACGCACATACACACACGCACCTCGCGCGTTTGGACTGGGTGACTGAAACCTGCTCTGTCCGCTCAAGCCGATCGCGGGTGAG
AGCGCACGTTGCTGCTGCTGCTGCTGCTGCAGGACTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN