Description :
From Genome Similarity Track
Location :
contig_237:11610- 12867
Transcript NameFunction/comments
g14923.t1hypothetical protein

Sequence
1257 bases(100 bases per row)
ATTACACCATTGCACGGCGTTGTTCACAAAGTCAACACTCAAATTCAAAAAGTGCGCACTCAAAATCAAAAACCTGTCAGATGTATTACCCTTGAAAATG
ATACTACGTCTCAGATCTTATCAAAAGTTACGTCCCAACTTCCATGTCGTCAAAGTGCAGCGTGCACTGGTGATGAGGCAGTGAATGGCAAAAACTCGAT
TGGACAGCGCTGGGGTCACCACTTCGGCAAACAGGGGGTCTGCAGCGAGCTTGAGATACCCGGCACGATGCTCCGTAATCGTTGTGCCGTCGGGGACGCG
CAGGATGCCAGGACGTTGTCGCGCGAGAAAGCGTTTCACAGCACTCTTGTAGACAGAAAATACATTCTCTATCGGGTTCAGCATAGGGGAGTATGGCCCT
AGCTTCAGCATCTCGGCATCTTGGAATTCCTCCTCGGCGAACACATCCTTAGCGTTGGTGTGACACGGGGCATTGTCGAGCACGAGCACGACTTCATCCA
GAGGGGTGGAGGTCTTGATGCGGCGCAGGAATCGCCTGATAAACTCGTTCGCGAGTCCAGCAGTGAACGAGCCGAACTGCGACTCTTGGAAGGCTAGGCC
AGTACTTGAGATAACAGCAATAATATTAATATGTGTTCCCTTACTGGAAACACCAGTCTGTACTGCGCGCTGCCCCAGCTTGCTCCAGACACGCCCACAA
GTTAATGTTCGTTTCATCCAAATAAAATACCTTCTTGTCGTTAGCGAGTGCTGCGTAGAACTTGATCACGTACTCGTAGCTTTTCTGTTTGTTGATTGAG
CTGTTGCGGTTCACAACGTCTCGGTGCAACTTCTTGAGAGTGAAGCTGCGGGCGTCTAGAGCTCGCCGCACGGTCTCCCGGTTGACAGCCACGTCGAACT
TCTGCTCAACAAGGTGTACCATCTGGACTAGCGTCAACTCTGGCGTCGTTTCGATATCACTGAGCAGGTAATCGACGTGAACAACAAGTAGCTTTTTTGA
TGACCCGCCGCGTTGATGTTGGTCACCACTCCAGTCTCCAGTCTCCATGGCCCTCTTGATCCAGCCCCATGAAATACGCTCGTTGACGGTGTGGAGCTCC
GCCACGGTTTTCCAGTCACCAGCGTTCTTTGCCACTCGCAGGATAGCCACACGCACCTGACTTGGGTACGTCTTGTACTTGGTAGTTGGCATGGTGCCAA
AACAGAAATGAGCCTGTTGGTTATGCGAGCGCATGCTTCGCACTAAGTTTCCCGCCA