Description :
From Genome Similarity Track
Location :
Scaffold_2601:1161- 2553
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2601-snap-gene-0.1Intraflagellar Transport Protein 57

Sequence
1392 bases(100 bases per row)
TCAGCTCGAATCTTCGTCGCTTTGGTCGTATTCCGGGTCCTGATACTGTCCATCTCCAGCTTTCCGACGGAAAGCAGCGGACGCTTGTCTCGACTTGGCT
TGCAACAGCGTATGACTAATACAACAACAAAAAACATAATGGAATCAGCGATACATCAAAAATGAAATGATAGGAGGGAAGACACGAAATAGGCTAAACA
CACAGTACCTCACGACACCGATGCGAAGATCAAAGTTCTTGATCTCGGCATTCAGCGTCTTCAATGCCTCCTTGATCTGCACCAGTGGAGACGTGTCTGT
CATCTTGCTGCCACGGTCGTCCATGACCATCTTGGTCTCTCGAAGCTGTTCGGTGATCTGCGCGTGCTCGTTGGTCATGACGTTCACTTTGTCTGATCCT
TCCTTGCACCGATCGCTGATCACTTGTAGCTTTTCCTTGAGCTGGTGGTACTCTTGCCGCAGATGCTCGTACTGGTTGTTGATAAGCTTTTCCTTTGTCC
CCATTCGCTGGATCGTCTCCGTGAGCTGATTCCCGATGATCTTCAGCTGGTTATTTGCAAGTGGTAGCAGATCATTTATAACCTACATACAAAGGCACAG
GGAGGTAAAAACCAAGTACAGCAAAACCATCATCGCCCTGAATTTCTAATTAGATGTACCGTCTCGTGTTTGCGTGTTCGCTCAATGTGGGAATGCCACT
CCTTGCCATCATCATCCTTCACATGCAGCTTGAGTTTTGGACCAACGCGCTCTAACTCCGTTTTCCAGAGAAGTGGATCCACCTACAGACATACACAAAA
AAAGTTAGTGAGAGAAGCCCGATGACAATTTCCAACACAGCACCCGCATCGAGTGTACCACACCTCACTGATGATCATCTGCTGGAACGATTGCTCGAGT
TCATTCTCTTTTTCGCCACTCCCCCCTCGCACGATGTCGACATAGAGCTCATCTTCTTCTTCAATTGGAACATCGTCGTCCGCATCTACCTCTGCGTCTT
CGTCGACTTCGGCTTCATCGGCAAAGTCTTCCTTGGGGTACAGTGGTCGCGCCCATCCGAAGTTTCGCGCCGCGAGTGCCTTGTCACACATGAAATCCAA
CGCCGCACACACAGCTTCGCCATAGCTGAGCCGCAATTTCGAGGCTGGGAAATCCAGTGGGAATCCCAGCACCTTGAGCGCTAGAATGAATTTGTTAATC
TTCGTGTTGGGATCATCGTACTTATCAAGCACAAAATCGTGGTTTGCCTGCTTCATCAAGTACTGAATCAAGTCGATAAAGCTCGTAAACTGCGCGTTGG
GATTACTGAACGTCATCACAGCAAACTGCGTCTCAGTGAACGGCGCCATGCCCTTTTTCTTGATGTATTCGCGCTCGTAGTTGAGCGCTCGC