Description :
From Genome Similarity Track
Location :
scaffold_236:11609- 12893
Transcript NameFunction/comments
g2534.t1 hypothetical protein PHYSODRAFT_478459

Sequence
1284 bases(100 bases per row)
ATTACACCATTGCACGGCGTTATTCACAAAGTCAACACTCAAATTCAAAAAGTGCGCACTCAAAATCAAAAACCTGTCAGATGTATTACCCTTGAAAATG
ATACTACGTCTCAGATCTTATCAAAAGTTACGTCCCAACTTCCATGTCCTCAAAGTGCAGCGTGCACTGGTGATGAGGCAGTGAATGGCAAAAACTCGAT
TGGACAGCGCTGGGGTCACCACTTCGGCAAACAGGGGGTCTGCAGCGAGCTTGAGATACCCGGCACGATGCTCCGTAATCGTTGTGCCGTCGGGGACGCG
CAGGATGCCAGGACGTTGTCGCGCGAGAAAGCGTTTCACAGCACTCTTGTAGACAGAAAATACATTCTCTATCGGGTTCAGCATAGGGGAGTATGGCCCT
AGCTTCAGCATCTCGGCATCTTGGAATTCCTCCTCGGCGAACACATCCTTAGCGTTGGTGTGACACGGGGCATTGTCGAGCACGAGCACGACTTCATCCA
GAGGGGTGGAGGTCTTGATGCGGCGCAGGAATCGCCTGATAAACTCGTTCGCGAGTCCAGCAGTGAACGAGCCGAACTGCGACTCTTGGAAGGCTAGGCC
AGTACTTGAGATAACAGCAATAATATTAATATGTGTTCCCTTACTGGAAACACCAGTCTGTACTGCGCGCTGCCCCAGCTTGCTCCAGACACGCCCACAA
GTTAATGTTCGTTTCATCCAAATAAAATACCTTCTTGTCGTTAGCGAGTGCTGCGTAGAACTTGATCACGTACTCGTAGCTTTTCTGTTTGTTGATTGAG
CTGTTGCGGTTCACAACGTCTCGGTGCAACTTCTTGAGAGTGAAGCTGCGGGCGTCTAGAGCTCGCCGCACGGTCTCCCGGTTGACAGCCACGTCGAACT
TCTGCTCAACAAGGTGTACCATCTGGACTAGCGTCAACTCTGGCGTCGTTTCGATCTCACTGAGCAGGTAATCGACGTGAACAACAAGTAGCTTTTTTGA
TGACCCGCCGCGTTGATGTTGGTCACCACTCCAGTCTCCAGTCTCCATGGCCCTCTTGATCCAGCCCCATGAAATACGCTCGTTGACGGTGTGGAGCTCC
GCCACGGTTTTCCAGTCACCAGCGTTCTTTGCCACTCGCAGGATAGCCACACGCACCTGACTTGGGTACGTCTTGTACTTGGTAGTTGGCATGGTGCCAA
AACAGAAATGAGCCTGTTGGTTATGCGAGCGCATGCTTCGCACTAAGTTTCCCGCCACCGGGAAGTGCATTTGACACCAATCAA