Description :
From Genome Similarity Track
Location :
Scaffold_394:11608- 13734
Transcript NameFunction/comments
Phymu_g9446conserved hypothetical protein
Phymu_g9447hypothetical protein PHYSODRAFT_354542
Phymu_g9448hypothetical protein

Sequence
2126 bases(100 bases per row)
GAACGTCCTGGGAGAGATGGACAGCTTTGTCCACAGCAACACCGGAGATCAACTGCGTTGTCAGGATGCGTGCCGTTGACAGCTCACGGTACACGCGTGG
CACAACGTACTTCTCACCCATGCCGCTCTGTTCAATAAGCTCCTTAAAACGTTCTTGATTCTCCGCCTCGTTGACGTAGTCGCACTCGGCCGTGAGCTCT
TCCTTTCCGACACGGATGATCTCGTCGATGTACAGACCACGCGGCAGGATATTGGTGTACGTCACTAGCCTCTTGAGGTTGAGCAGATCGCTGCCAATGG
ACTCGGCCACACCTGGGTACTGGATCTTGATCGCCACACGGTCTCCATTCAGCAGGGTAGCACGGTGTACCTGAAGCGATAACATCCAAGTCAAGAACGC
ACGTCACGATTTAGCTTTTTTCACAAAGCAAAACTTTGAGGCAAATGGTACCTGCCCGAtagaagcagcagcaatggggACATCGTCAAATTCCTGAAAT
TTGCTACGCCAGTCGTCACCAAGCTCAGACTTGAGCTGATGGTGCAGTTGATCCTTCGGCATCACGTGCGCACTACAAAAATATAATCAGAAAaccgtct
tcttcaaccaCCGCAAATCCTTCAACTTACTTCTCGCGAACGCGATCCAGCGCCACAGCCAGCTTTGACGGGATCATGGCTTCGTCCTGAATACTCAGCA
TTTGTCCAAGCTTCAGCGCTGCTCCTCTCATCGTACACAGAGTCTCCGCCAGCTTTTCCGCGTTGGAGTCCGACACCAGCGCGTTGTACGTCCCATTCTT
GCCACCGCTTCGAACGATTTCCGCTGCCGTTCCCACAGCAAGTCTTGCTGCGAGGCCTCCGAAGCCCAAAATACGGGACAATGGGGACGACGGAACGTGC
TTCTCTTCCCACACCTTGCGAGGcggctcttcctccactaCAGGGTCCACTAGCACCTTCTTTGGATCAGAaaccttcttcacctcgaTCTTCTCAGTCT
TCACCTTTAACTCTTGGATTTTAGGCGTCTCTATCTGCTCCTTAAGCACAGGTGCTTTCTCCTGTACTTTAGCTTCTGTCTGAACAGGCCCAGAGGGGGC
TATAGGCGGCGTATGAGACGTGGACCCTTCTCCATTGAGGAAATAAGGCACGAGGCGAGCCAATTCCGTCGCGTGCTTGGACAGCTGCCCGCTCTTGGCG
GCCACGTCGGGTCCCTGCGTACGagccacctgctccgcgacCTTGCCGGCGCCTTGCAGCACGCGTACGAAGTCCTGTGTCCACATCCTGAGCAGTTCGT
CTCTGTGTGCGGCTGCGGATTGCTGCTTGGATGGAATGAAGGTCACTGCGCGTGTCAATACTTGTCACGGATATGGTGTTCGATACACGAATTTCAAGTA
ACGATTCGATTAAGTACGTAAAGATCTCCCTTTTTGCCTTCAACGCCACAACCAGAACGGAAGCAACAATGGCCGGTAAGGCTCTTCTTGTCTTGATGGA
CACGTGGGTATTACTGTGTGTTAACTGAGTGTACGCAGAGCAAGTCCGAGCGTCTCACCTGCTGATCAAGCACAGCGGCTCACGTCGCCCTGCGTCGCGT
CTGTCCAACAACATCACGCGttccaaggaggaggccatCGCTACGCTGCTCGGTAGAACTTTATTCCTAGCTACGTGGTAAATGAAGATGGAACTGACTG
TTGCATACTGTTGGAAGACCTGCGTGGTCAGATCGTGTCGGGCCAGGCTAAGTTCGATGACCTGGCGGTGCAGTACAGCGACTGCAACAGCGGCACTCGC
GGCGGAGACCTGGGTCCGTTTGGTCGTGGCATGATGCAGAAGCCCTTCGAGGACGCCACGTTCGCACTTCAGGTCGGCGAGCTcagcgacgtcgtggaca
cGGATAGCGGAGTGCACATCATCCTCCGCACGGCGTAATTGAACGCCTGCGAGATCGTGTTTACGACTTTGGACAAATTGGAATTAACGGAATGAAAACT
CGGTTAACTTTCTCGTTAACGTCAAAAGAAAATGATGAAATACGTCTAACACTACGTCATTGTCGGTGCTCAGCCGGCTTGGGCCATCTTCCGTTCGTAC
AACATCACGTCGCTGCGTTTGCGTTG