Description :
From Genome Similarity Track
Location :
contig_62:11606- 12621
Transcript NameFunction/comments
g9223.t1hypothetical protein

Sequence
1015 bases(100 bases per row)
CATCTGGGAGCCGTAGTAGCGTCAATTGATCAGCCAGATCTTGATCTCCGAGGGTCTCGACAAAGCGATCCACATGTTCCCGGCGATCTTTCGGTTCCCC
GTCCTTGATCTTGAGGCGGGTACGTAGAGCAGCAACGTTCAGAGGTGGAGATACTCTAATGGTGATTCATCCGACCGCTTACGTGCGTGATAATACTGAC
AGGCAACCGAAACACCTAATCCACAGTATTGCACCTGGAAATAGCGCAGCAGATCACTCCGCTTGCTCCGAGTAGTTCGGCTTAGCTGGCGGTACCAATT
CTTGGCTGGGTCAGCAAGTAGATCTGCAAAGGTCAGACACTTCTCTTCATCCGAAGCTTGGTCTCGGAGAAATGCTGACTTGACCTTGCTGATCCTAGAT
CGAGCGCGATCTTCATCCTGATCTTTACCCAAGAATTCCTTCAGATCCGAGATCGCCGAGATCCGAACCCTCTGAATCATGGAAGTTCCATTGGATCCGG
CGGCTGCGGTGGCCACGGTGACCCGTCCTGAGCGTGGAGCTTCGAGATCGTCGGGATCATAATCCCATGGTGAGGGATAGTGGGATCCGACTGACTCCAT
GTCCACATCTTCGTACTTAGGTTCCGCGGGCACTTGAGGTGAATTGATCACCTGTTGTTCTTTGAGGAAGCGACTCATCGCAGCTTGGAAGTAGGATTCC
AAACTGCTTGTTGTTGGATCTGTCGTAGAGGTGATCGGGATCGTAGCTGCGGGCATCGTTGGTTTTGTCCATGGGTTTTGCGCTGCGATCGTAGCCACGG
GCATCCATGGCTCGTTTCGCGGACGTGGTTTTGAGATCGGGATCACCGACGCGGTCGGCTGGTCCCGCGGATCTAGTGGTTTTATATCCGCCACCTTCGC
GCGGGATCCGATCAGGGCTATTCCGGATGGGCCAAGAGGCATACGTCGTGGATCTGTAGAACTGTCTGAGTCTGGCTCCGAAGTAGCTGATGCGTAGTGC
GAAGACCCAGTCTGG