Description :
From Genome Similarity Track
Location :
Scaffold_74:116029- 124363
Sequence
8334 bases(100 bases per row)
CAGTAACGTTTGCGGAAATAATGGTGAACGAAGTAATCTCGCGACATGGAGTCCCCGCGAAACTGTTGAGCGACCAAAGCTCAAACTTCATATCGGGTTT
AGCTCGGTCCTCCTACGAAACGCCTGGAATTAAGAAGTTTTTTTGCGCTACTTACCACCCTCAGACTGAGGGCCTGGTCGAACGGCTCAATGGTACCCTG
ATTAAAATGCTTAAGATGTATGTAAACGAAGCGCAGAACGACTTGAACTTGTATCTACCTATTATGAACTTGTTACCTCGAGGGGTAACTACCAGGGGAT
TGCATCCACCACTAGTAGCGAGAAGGGTCCAGACAGTTCTTGCACGGGCAATCGCTGCATCAGGCCGTTTCTCCAAGGGTGATAACCTTTACCAATGCCA
CATACAGTACTTTCCGGGACGTACTCGGCTACATCCATCTTCCAGCCGTGCAAGTAAGCGTGCTTACGTACTCTGTCGAGTGTCTTTAACACTCTAACAT
GCGCAGCAAGCACAATCTTATAGCAGTGATGTAGTACAGCTGAAATGAACGGCAAGGGGATCACGGGTACTTCTAGGGTTGACGCGGGCCCGGCTTGAGT
CTTTAAAAGCACGCGACGCATGAGTACTCCGCTCTTTACAGAGTAGTTAGGGGGCATCAGTAAGACCTTTGTGCGCAGTTGATCGTCTAGAGCTAGAGCT
CTGTCGCTTAGGAATGCTACCATAGCCGGAATCCAAGGAGTCGTCTTTTATTCTTCCACAAAGCGTGTTTGTTGGAGTCCGAACACATCAATCCGGGACA
CCAAGAGTTGATCAGGTGTTCATTCCTCGTCGGGCACCACTGCACTAGCGTTCTCTAATAAAGATCCCGAGAGAGTAGGTGGTACGGACGAGCCCCGTAA
CGGATGACGACGGTCCTTTGACGAAAGGAGATATCCCTTCTATTAGCGTTGTGGAAAGACTCTTTATTGGAGGAAAAGAGACGGTCTTGACTGGGGCTCC
CTATCCATTGATCCACATAATCGCTAGGCGCAAGAAGAGCCGAGAAGATCCGTTCCTAGTCTTATTGGCCACTTACGAGACCCTACGAAGACCTCGGAGC
ACTCTGTTATATACTTACGCGGATCTAATCAAAGTGTTCGAGCAAACCCGTCGTAGGGAGGAGGACCTACCAGAATTACGTCGCAGCGCTCGGTTAAAAG
CTGCAAACGCCGCTGTAGACGAAGAAGAACTGCTCTTCTAAAAGAGAATAGTTGAAACGGACTGGTCGGTTGAGTTTGAGTAGCTCTCGATCTATTCTTT
TCACGGGAAATGTTCAAAGGAACACTTCTTACGCTGCTCTGTATATTTTGGATTTTGTGTAACGGATTGACTACCCTACTACCTGTCGAGAAGTTAACCC
GCGATTTTCAGAAGAGGGCAAGAGTGATGAAAACAACGAGGTAAATTGTGGGTGAAAGACAAAAAGAAACATTAAAATTTTGGGAGCGATACTACTACAT
CTACTCCTGTCCGGACGGAACCGTTGTGGGCTCTTACGATTCAAGAATTCGAAGGGGCCTTACAACTCAGTCACTCTATCGGATTCCTTCGTCGGTGAGG
TGGGAGTGGAGTGTTCTCCCGGCGAGCTCGACTTCTTCGGTGCCGATGGAGACCGCGACGCAGAGCGTCTTCCTGGGGATACTACCTTCTTCGTCAACGA
AGCTTAACGCGACCGCGAACGCTTGCATGTATCGTCCCGCGACTCTTTAACTGGGGAGCGAGTCGCTGTTTCGACTTCCGTGTGCTTAATAGAGGTCGAT
ATGTGCCCCTTCGCGTGCGAATGTGATCTTGTCTTCTCGCGCCGTGACTCACCCTCACCAGCCTTCGTGGTCGAAGGCTTAGCCGATGGCTTCGGACGTA
AAGCAGAATGCTCCACAGAGCGCGACCGACGAGACTTCTTGCGCACAGGTGATCTCGGCTACGACCGCAGAGGTGAAACCGAAGCCGGAGCATCGAACGT
CTACGGGTCGACGACGACATTGAAGTGTTATACGACTTTCAAGCAGCCGCCCCGACTTACAGGATAACGGTACCCCGTCGCCTTCCCGTCCGGCCTACCT
GTCGAGGTGACGAGCGCCGAAGCTAGAATGGTTAACCTAATGAGATAGCGTAGTTTCTCCGTTCGCCGAGGACGGCAAACACCAACTCGAGGAGGATATC
CCCTACCCGGGAACGAGGGGGCCATTTTAGGCGTCAATCGACTGACAAGGATGACCCGAGGTCTTAAGGCTACTCCTCGTCGTGCCGTCCCGTCAGGTTG
GTACCCGCTAGACTCGGCGGCTCGCGTACCCTCTGTCGAGCCTGTTAGCGTTGCCCTATAGAGTGGACCCGGAACGCTGAGACCCGTTCGACGTGGGCCC
CGCGCAATCGGGTCCCTTCCCAGAGCTTTCTGGTGTCCTGTGAGGGCGGACGTCAGGTGAAGCGAACTCGTCATTTAAGTGTAAGAGAAGCGGTGTTATG
TATGCGAGGAAGGGAAGGTGTTAGCCCTCTCTTTCGGGTACTTATAATGCCCACCTTCTACTCAAGCCAAGTCAATAAAGAAACTTATATTCGTATTAAG
TGTTTATATCTACCGTTCCGGCCACTAAACAAGATCGCACTCCCTGAACAGCCGCGGACTACCCGACCCTTGGAGGTGGAAGTATACGACAGGGTACACA
CCGGAATGTACCGTCAAAAAAGAGTGAAACGCCGCTGTACATGATTATGTGACGAAGCTCTGGATGGGCCCAGCCAATTATCTGGTCAGGCTTGGTTATA
GGTTCCGACCTTGGTCAGAAGATATGGAGCTGGAAAAAGATGAGTGCTGTCACTCCATCATCGATAGATTAGGTACTTCGATTTTCCCAAGAAGGTAAGC
CCCATAGTGCTTTGCCGGACTCGGTAGTCTCGACTCTTTCCCTGCTCTTCCGACGGCCCTTTTCTAGTCACGTCGTCATCCAGGTAAAACGCCAAGCTCA
CTTGTTTCAACACCTCATCCACCAGTTAAGTCAAGTCGAGGACGGATAGACTATCTTCTCGCAGCTTAATTGTTTGTAGTCGATGATTTCCGCACTTGTT
TCGGGGGTAGGCTGCACGAAGGTGTGCACTTTCACTAGCTCGTATCCACTGGCTGTTAATCTAATGGAAAGTCGAGCCTTTCCCCAGTATTCCAGTAGCC
GCTGCAGCGAAACACAGGCTTGAGGTGCGAACTACACGCTCTGGTGTATTTTAAGCTTACGTGAAAATTCTTTTTTGGGGTCTCTTGTCTTTAATAACTT
GCTCAGGGGGCTTTGAGGTCACGAGTCGCGTAATTGGGCCTCGTCATGACGTCTTCACGTCGCCAGGACGCAAGTTGAATAGTGAGATTAGCTTACGCCT
TTAATATGCAGGGGGAAAGAGGAGGGGCTAAATATTACCGTGAGCTTTGGTTACGTTATGTACAGCTTCAAAGGTATTAGCGGAAGCTGGAGCTGCGCTG
TATGAGGGACTTACCGATAAATTCAGTGAATATCTCTACTCAATGGCGATGTATCGCTCCTGAATTGACCGAATTCTCTGATTATCATTTAAGCGTTCAC
CGACTTGCTTCATATTGCACGAAAGCACTTCCGCCAATTCTTCATGCTAACGACGATCTGTACGTCAGATCTGTTAATGTAACGATCCCTTAATACGCAC
GCCCTACGAGCCGAGCATACGCTCGACTAGGGAATCTACCAGTGGTTTATGAGTTGCTGTTACCGGGCTGCGTGGGCCACGGTGCGACAATCGCAACCAA
ACGCCAACGAAGATGACGAAGAAAACAAACACGAGTGCCAAGAAGTTGCGGTTGCTGAATGATATTTCTACAATTTGATCTTAAGGAATATGCAGTGATT
AAGAAATTGTTTTTCTTCGTGATGCCGTTGTACGGCGTGCATTCGTAGAAGATATGCCCACCATGCTAACAGCAGTAGCAAAATCATGTATGCACTGTTA
CAACCGAAATTTCTGTGATTGGAGCTTTACAGTAACAAGCCAACTGGCGTCCAAATTTAGGTACAGATATAAAATCACCAACTGGGTCAGTTTTACATCA
GAAGAGGGATTAGGCCACCCATTGTTCTTCAAGCAGCATTCACTGGGTGATGTTACCTGCGGCCGCGACAGCCAGCATTCTTCTGTGGTTTGAGATGCTC
ACAGGATATTGGTTGTAAGAGGTCAAATTATCTTTTTTGGTACAAGTAGTGCATTCAGTTACATATGGGTACGCATGTATTCGCTCAAAGAGTGAATACC
ACCGCATTTTTCTGAGACATAGTACATAAAACAGACGATAGCAGGTCTACCAAATTACAGAAGACTGAAGAAAACGCGTTCTATCTGCGCGATGTCTTAC
TAATGAATCACATTAGAAGTAAATATTTTTTTGCTTAGGACGAGTGCCGTTCCTAGGAAAATTTGAAATAAAATTCAGAGAACATTTTCTTTACGAAAAA
AGATAATTATATTGTCCTGCAAAATAGTCAAGAACAGGCTACAACTTCAACAATGTCATATCTGATGTAGACCGTATACACGGAAATTGTATCGCCGCCG
GTATCCAGCATAAATCAACAATTGCTTTAGGCACAAATTAAATCCAGCCCCTTTGAGAACTATAAAATAGTTGTTTCAGATAGCAGTCGAGTTTATCTCT
TAAAATTTCATCTAGCTTTCATTGAACCCAAGTAGAACCCGGCTATAGATATTTCAATGATCACACCTCGCTACGCTAACACTACACTAAAAGCGTTAAT
CATGACCTGGCCGGATTTATCGCATCGTAATGGTAACCTCTTGAGGCGCCGTTGGCGAAGCGTGACTGACTTTGTAAGCGGAGAGACGATCCTCCAAACC
CCGGAACACTAGAAAGAAGCTCAGTGATACCGGTAAAATATAAACGATAAGTAATTTGTTCAGTATCACGGTAGGAAATCCTGCTTGAGGCACTTTACCC
CAAGGATGCGTCCTCTGAGGAATTTCAAAATATTGACATTTTTGAGCCATACATTCCGCGATCGACTTTGAGTTTCAGAGCTCACGGAATGATAAGTAAC
GCGGTGTAGTTACATAAAGGCTAAGTCCCCTTAGTGCTGGGAATAGCATCTGCGAGAACATCGAATGGACGACAGTCGAGATATGTTGAAATAGATCGAC
CTCGTAGGAGGTCGGACGGTCTTTCCTAGCTTTGATTAAACGCGGGGAGGTCGAGAATGCCCGAAAGTCGAACGAATGCCTCTTTCGTCGGTCGCATACA
CGTTGGAGCAGACAACACACATTGCTTCATTTGAGGTGGCATGTCAAGCGATGGCCAAAGCATCAGTGACTGAGTATGTTAAGAAACAAACGTGCATAGT
ATGCAGTGAGACCCGAAGTGGCAAATGGGGTTGATAAAATCGCGACCCCGCAGATCCTGAAAGTACGAGAAGCCAAAGCGTCAAGGATTTTCTATCTTAC
AAATGGTAAGCAAGCATGGTTCATGTTGAAGCATACCGTAAGTGTAACGGAGTTACATAATGTGGAGCCCACAGGGGTACGGAGAACCCGGAGAGTTAAC
AAAGGCTCAGTACATAAGTTGGAGAGCTAACAAGGTCTCTCAGTACCTAGGCCGAAAGCCACACGTTATGCATTTAATTAGGTTTAACTATGCTAGATAG
TTACGCAGATACATTTACCTATAGGCGGCTTGGCCGCAATAATAGTAAATAAAGCAAATCTTGTTTTGAAGCATAAAAGTTAAGGTATTAACTTTGAGTC
CTGGTCGTGGGCTGTAAGTGTCCTTCGGAATGGGGAACTTAGTGTTAGTGACTCTTTGAGTAAAACATCTTCCTCTGACGCTACATCTACGGCAGCTCCG
CTACACTAGGTAGCATTTGTAGCCAACCCCGCTGCTGAGTCGGCTGACCATATCCTCTCCGAGGATCGAACATTCCGTGCTCGCGAATATGCCCCCGGCG
CAGCAGGACGCGCTTACTAAGCTTATGGCCTTGCTTAGCCCTGAGGGTGTGGCTCATCTTGCGTCGCCAGTTCCAGAGGCGGTCACCCTTAGGCTGTAAT
CGTTCTCACGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGAAAAGATGAGCGCCGCAACGGCGGCGGCGTCGATGACGCGTGAAGAGTCTACGAGACT
GAAACCGCCCATGGTGAGCGTGAAAATCATTAAGGGGAAGGATGGAGAGAATTTTCTTCTCTGGACCCGTGAGGTCGCGATGGCCATGCGATCGGCCCTG
CTCCAGTATGAGCATCGGCGCATGGCGCTGGTTATCCTCAGGCTTGGATGTCGGGCTCGCGAATAGGCATTAACGCGCGGCACGTCTGCTAACACTGCAT
TTTCTACTTGGGAGCAGCTGAAGCAATAGCGTTCGCGCGTGCTCGCGACGCCTAATCAGGCGTACCGTATCCGGTCGAAGTTTCTTGCCACCCGGCAGGG
TAAGAAGGAGTTATCGGACCAAATCCAAGAGCCGAGAACCCTCATAGGCGGAATGGCGGCGGACCCCCTTCCGGAACAGGTCAGCGTGACCGTGTTCATG
GAGAAACTTTGTGTAAGCGCAGCCCGAACGGAAGTTTTCCATGTACACCCTAACGCTTTCGAAGAGGCGGTGGATGTGGCATTGAATGCCAAGCACAGCT
TCAGGTCGGCTCGACCTGGTTGGAGCGCTGGTAGCACAAGCTCTTCGAGCGGTCCGGGGATGAGGGACGTCAGCTATGATGAAGGCGAAGACGCGGAGCT
TCTTGCTGCTGAGCAGCGCGCCGGCATCCGCCGATGCTTTATGTGAAATACTTGAGTGTCTATTGCCATCTGCGAAAGCAGCGCGAGGCTCCAGCGATTC
ATCCTTCCGGGTCATCGCCGGGAAACGGTAACTCCCAGTAAGCGCGGGGCGGCCTACTGGAGAAGAATTAAGTTCTATTGAACCTCGAGTACGTAGAGGG
CAGCGGGGCTCAACCCCGAAGAGAGCTGAGCTCTGTTACGAGAAGTGTGTGCAAACCGGGCTTGCTGGTTGTTCAAGCGAGCGTGAAGGGCTCTGCAAAG
CCACGGAGAGTCTGGAGCCTTGGGCAACTACACCGTCGCTCCACCCTGAAAGGAAGTCAGCTGTATACTTAGGCACTGGAACTGCCAACGAGAGATACGA
ACTTTGTCCGTATCGCGACGGGGACACTTGTAACTGTGTCGAAGGTCTCTGTCGACCTTGGCGCGAAGCTTGAGAGCTTTCATAGCGTGAAACGCTGCTT
GGACTTAGACCTGGATGCGAGTTATAATCTCATCCTTGACATGACATGGCTGGAAGGCCATGAGCCATGGATCAACTGGAAGTCGAAAACGCAGGGTTCG
TTGCACCCTGCTCCTAGTGGATATTTGGTGAGTCATGAATCCACCTCTTTTATGAAGCACAAGCGCTTTTGGCGTGAGCACGAGGCCGAGGCCGTAGTGC
TGGACATTGGTATGTCAGAAAGCGTAAGCAGCGAGGTTGTCGTTCGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGATGAGCGATGCAGGTCAGGT
CAATGACCAACTGCTGGGTCCTGGTGAAGACGAACGCGGAGTGGCGCGTAATTCACTGAGTGGTACGGATCTGGTCGATGACCTATCGCTGCGTGGCCCG
AGGGCGAGTCCAGGCATCGTGGGCGCGGCCCAGGAGATGCAGGTGAAGTGACGCCTAGTTCAATGTGTGAGGATTAAGGCCCTCTTGGCTCTCAGCTGAG
TGTCTTGCGAGACACTGTCTCCACTTCGAGGAGTGATGCTGCTACTGCACCCGGTCGTGGTGATAGCGATATCGCCACACCGCCCTCATCCGGCCGGCTC
CGGTCGCGGAGGGAGAGGTGAAGAAGACGCAGGACGTCTGTGACGTTTTCGATTTCGGACGCGATATCCAACGTGACAAGCGGTGAGGGCCCACGGGATT
GCTGGGAACAGCTGTACACACTCGTGAGCGGGGTGACGGGGGAGGACGAAGGCGACATTAGCCTTGACTCTCCGCCCGTTGCAGATGCTCTGCTAGAGCT
GGACGAGATGTCCATTGCCGAGTTTAACGAAGCCTTGAAGGCAGGCAAGCTAGCCGAGGCGGTCCTGCTGAGCTAAGGAGGAGCTGAACGCCTCATGAGT
CGTGGACGACGCGGTCCAAGAGGGCGCGATGAAGGCGCTGAGTGCATGAACTAAATCCGCGATCCTTCGGATCCCTTCTACCATGTGATGAAGGAGTAGG
GAGACGTTGTCTCGAAAGACCCACCGACAGGCCT