Description :
From Genome Similarity Track
Location :
Scaffold_4:116006- 125558
Transcript NameFunction/comments
Phyca_LT153479926tRNA wybutosinesynthesizing protein putative

Sequence
9552 bases(100 bases per row)
aattggggacacagtgaatgtcggcaacaaggtgatagaccttcggagcgtatgacttgactctctcgacatgctcacacgtgatggtccaattcttgcc
gtattgtttggctagagctcgcatcgagtccagtacatgctgctcccatgtttcacgttcctctacagccacgttgtcgtgcacatgaaaccagccacca
ctgggtttcagcacctgtacagccaatggccaggccttttcactcgtaggcaacagtcccaaattcacacggtccgccactgcaccgatcgttggagccg
attcccggttgtctccaacataaactttgcacctgtcagctacgtggttgcgctccaagttgaaacgtagcgctgccactgagtccggattccactcgca
tgcgtggacaaacgcagcaccaccgtgcacgaggaatgggagaacatagtagccgatgccacagaagaggtcgacaatagtctccccacgacacccgatg
tttgccatacgggctttctcagtgacatttcctgacgaaaacatcacccgtgtgagatcccagccgtaaatgatcccattctctcggatctccacccaac
caggactctgcttactacgctgcgaggtgagggccttgtcattcacgtacagcagctccacgtggctctgacgcttttcgctggagtcaatataggcttt
ccgtgcaacacgagagaatgcaggagtagtggacgtacaaacgtgtgcccacatttcgtcagcgaatggtgcccactctggttcgaggaaggagtcacgc
ggaaccaacaaaacgtcactcacgaactcgtacttgtccggaataaccttgacgatctccggacgcaaccgatacttgttagcgaaggcaccaattgtgc
tgcggatcacttcgttgcggtttaggccacttgtcttgccaaacttgttggcgtacgcgtcattgtcagtcacaacctcgagattttgtagttcggcatc
atttgtcgaggcaatcagttcacgaatagtcgctgccacaggaattaggaacatcgtcgttggctttccacccattgtagcgtcattagattgcgtggta
tttgcaacgtggacgcggcgcgatttgtcgtacacttgtgccttctccaacagtgtctttaccttcttcacttgcagtttcccaacgagaacaccaagcg
gcttgtcatctgaagaaacaagcccactgctagtgctcgtactgattagcttgctcttcgtagcaacattggcagacgttttcttcgatgcaactactga
tagctgacactgatacgtcgacgagtaaaactgcccgaagccaaagcattggaatccaccaccgacgatgtaaagagaattgttggtaggcatccagacc
acgctgtgtcccacgaacgctgcattctcgtgcttcacctcaccaatctccatccattgagaagtattgatatccagcaagtatgccttttgtgtagctt
tgtcacctttcgcaaccaaggcagatgtcattccgcctgcaacaacgatctggtgatcattgataggagaggcgctggctgcgaaaagaacaggaggttg
gcttttgttcattgtgttttcgagactcttgtgttcccaggtctctgatacagtatcaaagagcgagcaagcgctgctagaacttttgatatcagtgtta
atgtccccctccagtgaagacaaacctccccaaaaaacaagcttggtcgcgttaacaacggaagcaatgtgatcgaatcgacgaggaacagaagggcttt
ctgcattcatagcaataaaaatcgattagcaataggtagacacaagtagactgggtaaaagacttaccgatttgacgccatcgcggggggttctggtcta
gatctagagaaaataggtcaccaaaaacgtgatcagcatcccgacctccgtgcacgtagacaaccgagccaactgtgataaaacaaaatgatcagtcaaa
ttcggttccacaatttctctgaagcaaaaccatcgccttaccagagcaactggaatgcttccaacgcggagagggaccgactccttgtgcagcaacatgt
tcccaccgcttcgtctccagatccatcgcatagaggtcgcccaggggcttcgcggggctagcacgacccccgaaaacgatcatccgcgttcctacaataa
cagccgagtggtacattcgagctgacggaccatccgttccggtcgaggcttggaacgtcgtccgaagattgccgtcaccggaaggggtcaagaaaagtac
gtctgaaacacgagttgtcgtgccggaggaggtgggtccttggccaccgaacacgacaatattatcgttgtactgcacgcttgaatgtccgacaagcttg
acgctggcttcgctgatcacttccttccaagaactcagctcaacaagagacccctttccagcgtttgctgtctgttcacaaaatttcgcgcggaaagcgt
caaacagtcgatctgttttctgcttgttggcttcgaacttctggttcgcgacgtccacgatccacctgaggtagtcctcattgacgagcaactggtctgc
acgtcgcccaagtgggatctccaatccgtttgccgtcgtacgaattgcgcacatgatttttcgatttccaagaacaacgccggattcacggaatccactg
gcgattccccactgtaacagttccttcgcagcatccaaatcgcgacacactacgtgcatgatgaatggttcgtgcttgaagataatctacaaataaaagt
aagcaaggcaatacagaataatatgcagagacctaagtacagcgacccaccatgttgctagtactgctattggcatcgggcgagcgcaacgctatcatca
attggtcgaaggtgatagtgccatgctctgcaatcaaccacttgccacctttggtgatcagatctgatccaccttccttgccattgccagcggcagcttc
accgcagaaaaccgcaatgcgacccgagcatgaactacttgtcacctaaaatgcccaacaatttgattgtcagtacttttaatgacatacaaaagcggtc
agcaactcacgtaatccggatgagcattaattgtcttgatcatgtccacaatgggttcatcgatgcagcccttggggctcttatcctccataacctgcag
cttgcgcagactctcgcgcttgagctgcgcgaacatgtttcgcctccaatcgtcaacgatgcacaaaataatagtatatagtccgactcaaataaaagta
tgtctaaaaatttagttcaactttttacaaaaagtagcctaaccatggcggaagacttgccacgggtccgtgtgcattgcgccggcgtgcgcaccaacca
gacccctacgctgccggtagacaacgggcgcgtgttcttcagcgaatcacagtatgattcatccccttatatcgtgcgtgtagctctcgacagcgtcagt
ttcgtacatcgcgggactcacgtcgtggagcggcggtttgtcttcccagggcgcattttgcacgccgtgctcgcagatttccctcacgagccattaaact
ccataaaactttgtcgtgataagtccatggaggctcgagaaacaaagaaaacggttctaaaacctcgattacaccctcatttatgtgtgctggtgcgctc
ggactgcttaaacgtgtacactgcagctggggaagtattcgaagtggctcttcctttccaggccaataggctatttcctatggataattggggtctattg
ctgcaacgcagtccagcggtgccaataccttctaacacgccgtcgaagcgaccaaaggatgctgctgcagcggcgttggcaaggaagaatcgacgtgcaa
gcaccagcaacagaggggatggagataggtacaagtacagctctggagagaaaggaacggtatcaaggccaaggtatttcaccctcaggcatccgctgga
tgaggttaagcctgtggctttgaagtcaggaacagctttagggaaaagtggagataaattcctgtcggattcagctttggaagctgtgaacgtgctggag
gataacgtacctcctcttctagtggcgtatcatcgatgggagcagaggttttgtgtcttccgaatgaagacgttggagaaagtggcaaattgttcgatat
ctgcagtgaaagtggtggatggaccgacgtggacaagataccgagctagaagtgacctggaggaacttcgtgtgcgaattgaacctgactggtcggtaga
aatgttgtggaaatctccacgggtaggtcccctaccttcgaagccaatgtttctctcgccgatcctctcgccaccttctcttttgactggttcatctgtc
ccgccatcgccaattgtaacacagtcttcggcgatgtcatcgggcaatgctactaaggtgtcttttatcgcgtcaggtgtcgatggctttccagtattgt
gcataatggataaagatgccgaaacgcttcttctgaagcctgcttccctgaaagaaaacgctttacaagttaacgaaggtgaccatgaaggtggcggtgt
ttttatcttgcgctgccgagatgccgttccaatccgacagcataatcaaagcaacttgtacggaagtggtggtaatcaaggcctggagagtttaccagat
attgtggtgctagaaaaagatcgcacgctcgtgctgtataaagcccaccagccagtttgcaccttgactcttccggacatagtgcaatgtgatcttggtg
ctgatagagtgaatgcgagtggttcagagattcgattggcccctaatgtgcagctaaactcaattggcaaaggctatgcgtatgagatcgtgtaccctga
cctgtgtggtagtcgcagcaggaagatttggcgatgtgagcatcctctaacagttgtggcttcttcactactacagcaagttttcgatgtactggattgt
atcgttcctccggtggaaatgtgtgcgtttaaggcacatatcgtttgctcagcacaacaaaaagctgagagctctgcacaagttgacgtcttcccggata
gtgggtttgaatggaaggctttctgtgagagtattgctggtttgcttcctgttggccaagatgaatatgcagtaacgggaactgttgatgatcaggagtc
tgtttcttctagcccgtcgtcttttgataaactttgtcagagtgaatttcatagtatctaccagtatgagcatgctatgcttttcgctacaatggatcta
cccgtcacagagttgaactcaaccgatcagaaaattatcccagtgaacaacaaaatgacatattctaagatggcagaatgtatccaggacatatttgccg
ccttacacttgttatgtgaagatctgaagttgtcaaccgcgctttaccgtgagcgtttgtttctggcggagttgctgctggatatgtcggtgcaactggg
tgtggatccttttataaggtattatgaggaagataactgtatcctaaagcagcaaacgacacggatagtgaaaaacaagtcgaagattgaaggtggaaat
ttgcttctttttgccgaatatggagctgtacccgacttattcgcgtggcttcaaaataagatgtcaaccaaagcacacaacatcccgggcttcccaacgc
tgtttgatgacgacggacaaatgcagagtccctcggacggtttggtccgacacgctgacaatccgcttcggcgctccacggcaatttgtcgattgtacga
tttgctatattcaaggtcatgtgaaggggagtcgtcagcattcaagctggtcgtttacctcactcaagatcccattggtagctctctctcgttggacgat
cttcccgttggtttaagcttccctatcgcccaagccattcgccaggtgaaacaccacccacctcctactatcactgaggatatttgtgccttcgtgggac
gagaagacctcagtatcgcgagtgcagacaaccttgcagcccattttgactatcctcatcaccagcaacagagcgcgggtaaagctggagacccaaagga
tttgggacgcgatgactcggatggtttagaagacattatcagccgaagccagccgctctttcctgccgaccagaggatgaaagaggctgcacgactgcta
cgctcaagccgccctttgtgcttgaaattagagaaaaccccagatttgtcggatctcgactacgcccagcaacagcaagctcgcttgttgcttctttgca
agcgatcgatggcgttatctgtggcacgcggtatggtcacattgggcagcttcgatgtgtcaacagctcaaactcaaatatggcgtcttaatatccctgc
tctgccacttcaaggtcgtaaaccaccgacaaatgcgatagtggagcttgatctgtctggatacgctaaagaattgacgtattggcctcaatttcacaac
ggatgcgccacagggcttcgactaccagctcacgatctctcaggggttatcaatcgccactggattaagtatcatcgaccgtcagtgaacgacgtctcag
ttggagagcaacaagcatctacccaggcggctgatactactggtcgcagtttggaagaagcttatgctgcccacgccggtttgctacttggaataggctt
acgcggccacctcaagtgtttgtccatggccgatgtatacaactacctgtcgttgtcaaacgagttcgtgaccgttgccatcatgctcggcatggccagc
accgctgcacacggtcgtcgtaagcggaaacagcaaaatgctgcgacgaagccggaaaacaatgaagaggaaacgggtgaagatactgagatgacaagtc
attttttctctggattcccagagctggcatcgtctgacaagactcctttgcttggaacaggcttggagttggcgttggagcgatccgtgtccaagatgct
ctgtctccatgttccatccctactgccttcgccatttggagggttttctgtgcctgcttcaactcagacggcagctttactgggccttgggatcctgtac
caaggcactgggtatcgtctaatgaccgagcttctgcttgccgagatcgcccgatctccatcgagtactcaatttgtgggaagcaacagtaacgcgggtt
tttcaacggcgtcattcgaccaactagagggttacgctttagctgcaggaatggcactgggtcttgtagttcttggccgcgggcaggccacaacaggaga
cccaggactggccgacctcaagctagaggaaaaacttcacaagtacattgtcggtggtgcccagcagtttagagacacaaacgcagcaggaagttgcttg
tatcgcggtcgtcgttggcagacgttcggtgctgggggcaatggatataattcttctgttaacggcagtgccactggcaacagttcatccaatgccaata
cgggaggatccccaggcgctggtcgcgatgcaaagcattcaagtgagcgcagtggggctcgcagtagtggcgaacacgtgaatgttggtgtaactgcgtg
cgcaagtgctttggccttggctttcatgtacatgcagactgacaatatggctgtggcagcacaactggccgttcctgacacattggtcctgttggactac
gttcgccccgatatcctgttggtacgcacattagccaagaatcttgtgatgtggaacgacatttcgccgacaacagactggattgagcagcaccaagtcc
ctgcgcaacttcttcacgcgtacagatcgattctatcgcgcaatggtgatgatcgttcatcacacgctgatcttcactcaatctgtgaagcctacgccaa
cattattgctggcgcggtcatgagcattggattgcggttcgctggaacagaaaacacttcggctagggcaacgcttcgcaagtatgttcttcactttcgt
gaactgagagcaaaggcctcgtcgtcatcagttcttctgcaaggaagtagcaacgttgtcgctgcggcgaccgagcgtgcaactgttgaacgctgcttag
ctgtgtgcgctcaatcactagcgttggtggacgctggaacgggtaatgtggaaactctcacactgttgcgttccatcacattaaggcaacgtgttgacgc
ggccatgagctatggcaaccacatggctctgagtatggcgatcggcttgcttttcttgggtggcggacgtgccaccgtttctcgatccaaagaagctatt
agcgcgcttgtgatttctctctacccgatgtctcccatgaatactgcggacaacaaataccatttgcaggcattccgccacttgtacgtgctggcgatcg
atacgtcacgcttactggagactgtggatgtgaatacgaaaacaagcaaagcagttcaagttcgagtcgattttcaatccggcgactatggatctcaacc
accgtctcggatacttcaaactccatgtcttctcccagatatcacgacgataaaacgtcttattatctcagattccgagttttatccgattgaaattctt
acctcgccgtctggcgaacggattaatgtggaggctgaaaaagtgagaacggccaattttctacgcttggagctcttgcgaaacaaaaacgtggtgtttt
taaagcgcagacatcgaaaagataccggggtatttaatgatgctaaaggagagctggagcaactgcgtgatgtgcacgtgggttaccatggcgctgccaa
tcacgacgacagattgtggagagtttttcgttcatactttaagtcaggtgctgtctatgacgaggatgaatttgacgatgaggaggacgaggtggcagat
tggggcagcaattggtgggcgtatcagctgagctcacgaacgttcgaccaagtccgagaggaggtgcaatttctgctgccaccgtatcttaatgctctac
acgcactgttccgaattcagcaggtgccgcaattggcaagtgctacggaggtcgtggatttaaacatgctgagcaggtattgtgcagagtcgagggttga
agaaagaaatttggcgaaaagcagctcatcgctgcctgaattcggtgtgtggctcacgatccaaacggaagaagctcttggcgctctttggcgtcgaact
tcagttgatatcacctccctagcttcagctcgcgttcaactcctggtggaagctacatgcacccagcccacaaagcagacgttggtggatgcttttttcg
ttagtgtactggtgaggtacttcgctagtccttcagtattctcgctggcaaccgcagaccagtttaaagcttctgacagagattggaaggtcaagtttca
acgagtgctggctgcatgctcgacagaattttcgggatcaaaggctacacgattccagctatcaacttttctggatcaagatgagtgtacggaagcagag
aaaacgttctggctaaagctggtgtcgttcttcctgttttcaaactagcgaa