Description :
From Genome Similarity Track
Location :
Scaffold_1656:1160- 4144
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1656-snap-gene-0.1Isoform 5 of Mucin-1

Sequence
2984 bases(100 bases per row)
ACGCTCGCGGACCTTGCCAAAGAGGTGTCCAACTGGACGCTGCACTCGGATCGCGAGCTCCACGGCTTCCTCAAGCAGTACTCGAGCGAGCTTTTCGCGC
GCACCAAGCAGCTCGAAGACACGGTGCGCGACATCGCCATGGACGCCGACTCGGCCAGCGTGCGGCTCATGAACACGTTCAACCAGTTCCTCATGCTCTC
GAACAGCCAGTTTATCGAGAACCGCGTGTATGACGAAGAGCAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTCATGGGGGCCGAGAA
TTCGATCGCGAACCCCAGCGCGTCGACAGGGAAGACCGAGGAAGGAGGCGACCCGAACGGCACTGAGACTGCGACGGCAAAGACAGAAGCGGCGAATACT
GCGAAGAGCGCGGAATCGGTCGTGACGAAATACCGCACGGCGCTGGAGATGGGGCTCGAAGCGATGAAATTGTTTGCGATGCTCGATGATGATGACGACA
CGAGCGACACGTCATCGCAGTTCGACACCGTCTTGGATATCTACAATGAACGCCCATTGCCGTTCATTATCGGCACGCGCGAGTTCCTCGAAGACGAGAC
GCTCGGCCTCGGCGCTGCGCCTGATTCAGACGATTCCGAAAGCTCAAGCGACGAGAGCGACTCAGACTACGGCTCGTCGTACAGCAGTTCGGACGAATCG
GTCTCGTCGGCATCGACTGCGCCGCGGAAGAAGCGCGCGTCACGCACAGCAGCAGCAGGAGCAGGAGCAGGACACGCGAGCTCGGACGAAGAAGACTCGG
ATGGTTCGTCGCTAGCGCCACGACGACGATCGAATTCTCAGGAGAGTGATACAAGCGGTTTGTTTGGACGTCCACCAGCGTCCGAGCCACCGCCAGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACAGCAATCCGCTTCTGGGTCGCGACGAAAACCAACATTTGCATCCGACGCG
GACGAAAGCGAAAGTGACGACAGCGACTGGTCCAGTGACAGTGACAGCGACGATGACGCACAAGCGAAGCGGAAACAAAAAGCGAAGCTTGCTACCGCGG
CGGTGTCGATTCCGCAAGCGCCAGTGCCAGAGCTGCCACCGCGAGCGCAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GATAGCTCGGATGACGACGACAGTGACGGCGGATTGTTCGGTGCACCACCAAAGTCCAAGCCGACGAACGCATTCTTCCCTGCGGAAGAGGAGACCAAGC
AGTCTGCACCGACGTCGCTTTTTGCAGAGCAATCCAGTAACGACCTTTTTGGCGCCGCGCCTACTACTCCTGCTGCTACGCCTGCGATCAAGCGTCAGCC
GTCTCGTCGTACCGATTCCTTTGACTCTTCTTCAGATGATGATGATGATGAAGGCAATGCGCTGTTTGGAAGCAGTGAACCGAAGGGAAAAGCACCGCCA
CAGCAACCTCAGGGCTTCCGCCTTCCTGCTCTCGGAAGTAAACCACAGGAACAGCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGA
AGCTAAGAGAGTATACTTCTCCGATGACAGCGACGCCGAATCGACAGTCAGTGGCTTGTTCGGGAGAACCTCGAGTAGGAAAGCACCTGCAGGTGCTGCC
CCAATTCTTCCACCACAGCAGCGACCTCGATTGGATTTATCTGACGACAGCAGTGACGATGGTGACGATGGTGGTCTCTTTGGTGCTGCGCCAAAGAAAA
CTGCCCCTCCTCCAGTATCTGCGCAAGCGAAACCAATTGTTCCTCCAGCTGCTGCTGCAGTTGTTCCTCCGCGGCGCCCAATGTACTCGGATGATAGCAG
TGATGATGATGACGATGATGGCGGTTTGTTTGGCGCTAAACCTGGTCCCAAAGCGGAAGCCAAGCCAACACCACAGCCCGCACAGCTTACGCCGGCAAGC
AATCCAGTTCCTGTGCAACGAGCTCCAAAGAGCTCGCTGTTCGACGAAGAAGACAGCGATGAAAGCGATGCAGGTGGTCTGTTTGGCGCCAGGAAACCGA
CTAATGCTGCGCCACCATTGAGAGCTCCTGCAACGCTTCCGACTACTGTTCCTGCTCGAACCGCACCAGTGTTGACGCGCACTATCAGTGATAGCGATGA
TGATAGCGATTCTGATGGAGGATTGTTTGGTGCGCCAAGAACTGGAGCGAGTGCATCTCTGGCAGCACGTCCAACGCCAGTTGCTGCTGCTCCACCACTG
CAATCGAGGCAATCACGGGTGCTCAGTGACTCGAGTGACGCCGAATCGGATGCAGGTGGCTTGTTTGGCGCACCACCAGCACGAGCACCTCCAGTGAGCG
CACCGCGCCCAGCGCCAACTCCAGCACCTACGCTTGCGCCAGCACCAACTCCTGCACCGGCACTTCGTCAAGCGCCAGCTCCAGTGCTTACACCTGCTCC
AGCACCAACTCCAGCACCAGTGTCTGCACCACCTCCACTTGCAAATCCGCTCATGAGCCGTCAGGTTTCTGACGATTCCGATGACAGCGATTGGAGTGAC
GATGGTGGACTTTTCGGCACGGCTCCATCAAAGCCAGCAGCAGTGTTACCAGCACGAGTGGCAACGGCGCCACCCACAGCTCCAGTGTTGTCGACTCCAG
CGCCTGCTCCAAAATTACAAGCGCCAGTGTTGTCAGCCCCAGCGCAAGTGCCAACGCTGCAACCAGCAGCACCAGCACCGTCGCTCTTTGGTGGCGAACC
GTCCTCCTCAAACTCTCTTTTTGGTCCTCCTGCAACGGCAGGTGCTCCAGCTGCTGCAACAGTCCATCCACCAATCCCCAATGCAGCCGCGCGATTCCGA
GCTGTGGACTCGGACGATGATTCTGATTCCTCCGACGACGATTGGGATGCGAGTGGTAGCCTTTTCGGTCCGCCAAAGAAGTAA