Description :
From Genome Similarity Track
Location :
Scaffold_1215:116- 3964
Transcript NameFunction/comments
Phymu_g12942hypothetical protein

Sequence
3848 bases(100 bases per row)
AGTCGACACTTGGATGATCTTGGCCTGCAACAACTCCTTGATGAgatccgacagcttctcgcgGTACTGGGGCGCCACTTTGCGCACACGCTGGGCGATC
GGCTTCGCGTCCCCGACGTCGATGTCGCACACcgctccgacagcagcaggcggtaGGGCATTGCCCTTTCCGATCAGCAGGTGTTTGTACTTCCAGATCT
CTTCGGTCAGTCGCTTGATCTCATCCGAAGTGTTGGTCGCTGGATCTCCGACTTGTAGGTCCTCGATCCTCACCTcgaccgtcgacgccgtggTTTCAGG
CAGCACTgccagttccttctcctgccCCTCTGCATGCAACTCGCCGCTCTCGTGCAGGTacactgcgtcgtcttccactgggCTGTTGCTTAGGCTTGGG
CGGTCTGCGCTGCATCCAGGATCTGGGCTGCCGGTCGGAGCCTCTACGGCGGATCCACTTGGCGCACCCCcaacttcagctgcagcatacACGCGAGTCT
CATCAGCAGGGCAcacgtctggagctgctgttgcactTGGTGGGGTGCCTGGCGGGgccttcgtctcctcgtAGCACGTCCTAGATCTTGGGCACTCTTG
GTGGGGGCCGCCGTCGTCCTTGTGTATGCCTTCCCGCTGTCCTTGAGCCGCACCTGGGTATTCTCCGTCGACGTGAAGCGCGCCATCGCCACCCTCTCGG
CGAGGCGCATCTGGAACACCTTGGTTGCACGCGTAGAGCCCCTTGGGGGCGTTTGTAGCTGCCGCGCCCTTCCTGCATGGCGCAAAGCTGCCGCTCGTCC
GCTCTTTCGTAAGTGTGAGCGTATCAGGTCTCCGCTAAGTGCGGAATCAGACGGTCGTCTGGCTGACTGCTCCTGTCTCTGTCCCGTGTCGCACGAGACA
CGCtgatcttccagcagtgcagcGACACAGTCGGCTCTGCTTGTAGGCATCGTTGAGAGGCCTACAAGCATACCATTGGAAAGGTCCTGCTCAGGCGCGT
TTGTTGGCACCACTCCGGTCACTGGGGCACACCTGGGGGCTTCAGGGCACGCTGTAACGTCACGCGTGACTGTGCCCCATGAATGATGGTCGTCACATGT
CGCGCGATTTGACGGCGACCTTCGggcttcaacagcagcagacttGACACGCGTAGAGCCAGGGCGGGGACGTGTGACGTGGACATGCGCCGCCGTCGGC
TCCGTCCGCTTCAACAACGCCTTGGGCTCCGTGTAGGTCGGACGCTCCACTGCcggctccagctcccagGGCTCCTTCGGCcgcggtggcggcggcaacT
CGGTCGTGGCGCTCGCGGCGAGGTTCTGCCACTCGTTGTAGCGCCGCGAGCCGACTGAGATGAAGCCTGGGGCGCGAGGGACGTGGTCGCCAGTCAGCCA
CAtgccgatctcctcgttgTGGTTCAGGGAGATGGCCTTCTCACCGATGTTGGTAAGTTGTAGATAGCGGACTTTGCCTGGGCCTTGGACTAATGTTGGT
ACCCACTGCTTTCCCCttcgcagccacagcttctcgtactcctTCAGGCGGATCCTGTCCGGGTGCTCGAACGTGTCGCCGGGCTCAAGACGGATGCCCT
CCTGGAGCAGCAAGGGCCGGGCTCGGCCGCTGAAGATCTGGCGCCGTCCATGAAGCCGGATCCGGACCTCGTCGTGCAGGCACACGGATCCGTCGCCCAA
GTCGAGACGGATGCCTGCCGGGACCATGAAGTCCATACCGAGGATCGCGTCGCAGTCTAGTGGAAGATCCTCGCCGACCCACACGTCACAGAAGTACACC
AAGTATCCAGCTAAGGTAACCTTGATCCTTGTTCTTCCCATTGCAACGTACAATTGCTCACCAATTCCGAGGCATTCTTGTGTTTGACTAGTGTCGATGT
GGGATCCAACCTTACGAGCAAAGGCGGCGTCGATGATCGACACCTCGGATCCCGTGTCAAGAAGCACGGTGGACTTGGCGTTGTTGATCTTGCACGTTGC
CTTCgcctgcttgaagtgcttgCTGGGTACATGGTACTTCCAGTACCCGCGTGACTCACCGGGCATCAGATCCAAAGCCATGGCGACTTCAGATCGTTGA
TACTCGTCCACAGAGCGGAAGCTTGCAACTTTAGCCGTACGTTTCCCATGCAGTTATTATCAAATAGACCCGCTTGCTTGTCGCTAACTTGATCCATTGA
CTTCTTGTTCACATATGCATAGATGTAAGACGTAGAACGCTCATCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATcttctcggcagctt
cgggcAGCATGTGCTTGCTTGGATCGAACCACTGCCGAATGAGGTTGTAGAACTCCTCCATCTGGCACTTGCCATGATCATGAAGCTCTCCGCAGCCTCg
gcagacgaagaagcagcgatCCGACGGATGGCCTCTCTTGCCACACTTTTGGCAGgtcaagcgcttccagcagccgaGATCCGAGTGCTTGCGGGATCCG
CAGTGCGAGCAACGTTGTCCCTCATTGGGATAGCGAGACCGACGGTCCTGTGACGTGGAGTCCGTGCTGGTCTGGGTCGATGCCTTCAGATCCGGGGATC
CGGTCGCTTCCTTGGTCACGTCCGCTTGCTTCCGCTCGCTCAACGCTGCCACGTAGGCTCGGCGCAGCTCCCCTTCGGATCCTGACTCGCCCGAGTCAGA
TCCGTACTCAGACTCAGCCATTTGCATGGCTCGGATCGCACGTGTGGGACCTGTTGGCTGCGGCACTGCCGGTGGCTTGGGGCGAGGCTTGCTGGATCCA
GACGACGGCTTCTTCTGGCGGGACTTGGCGCGGTACCGCGCACGCAGTACGTCTACCAGTTGTTCGGCGTCGGCAAGCCGCAACAGCGTCAGCTGGTCTG
CGAGATCCTGATCGCCGAGCGTCTCGATGGAGTGCTCGACATGCTCTCGGCGGGACttggcgtctccatccttGACCCTCCGTGGGCACGCATGCCGGCG
ACGTTGAGGCGGTACAAGTACTCGAGCGGCGACTCCTCCGAACGCTTGCGCGCATGGTAGTACTGCCAGGCCACGGACACACCAAGGCCACAGTACTGTG
TCTGGAAGGATTACAGCAGCTCGCTCCACTTCAGCCTCGTCGACCGGCCGAGTTGCCGGTACCAGTTCCTCGCCGGGCCCGTGAGCAGATCTCCGAAGGT
TAGgcacttctcttcgtcagAGGCTTGATCCCTTGAGAATGCAGACTTGACCTTGCTTATCCAAGCTCttgctcgttcttcgtcatgatcCTTGCCTGTA
AACTCCTTCAAGTCCGAGATCGCGGAGATTCGGACGCGCTGGATCACACTGCCTCCTGCTGTGGGTGCAGCTGCGGCTGTAGCCGTCGCGAGCGTGCGTC
GGGGGTTGCTCCCTCAAAGTCGTCAGGGTCGTACTCCCAATTGTCGGGATGCGAACCCGTGGACTCCATTTCGACTTCCGGGTGCTTCGACGTTGCGGTC
GTCCGCGGGTCAGCGGTCAGCTGTCGCTCCTTTAAGAACCGATCCATGGCAGACTGGAAGATCATTTCCAGCCTCTCGGTTGACTCGTGTGGCGGGTCCT
TGACCAATGTTCGAGTCGGCAGTTGACCGAGGTTGACTGCGGCGGACACGGGTGCCGGGTCAAGGGTCCTGCTCGGCAAGTGAGCTTGCAGCATGGCAGA
ACCTGTGGGTCCCAACGACATACGACGGGGTTCAGACGAGCTGTCTGAACCGGCCTCCGACGCCGCGGAGGCGTACCGCGACGACCCCGTCTGGTACTCC
GGCAAGTGCACCTGCacgttcttggtcttgcgcCTCTTAGGCACGCTG