Description :
From Genome Similarity Track
Location :
scaffold_22:116- 17272
Transcript NameFunction/comments
Pl_112003conserved hypothetical protein
Pl_112004hypothetical protein PHYSODRAFT_321672
Pl_112005conserved hypothetical protein
Pl_112006hypothetical protein PHYSODRAFT_554287
Pl_112007vesicle-associated membrane protein, putative
Pl_112008Major Facilitator Superfamily (MFS)
Pl_112009hypothetical protein PITG_03168
Pl_112010GPN-loop GTPase, putative

Sequence
17156 bases(100 bases per row)
TGCTTTGTTTCTCCCATGGTTGCGATAGACCAGCGTCAAAAATAGTGGAGAGTGTGGAGGCCACCAGCAACCGCCGCAGTAGTTCCTCTCAAGCATTCTT
CCACACAAGTTGAAGGGCGAAGTGAGAGAGCAGTAGTATTCTTACGTTTACAAGCATTAAAGCGAGCCAAGATGTCGGCTGCCGACTTCGATGACATCTT
CGGTGAAGATCCGAAAATGGACGCAACAACAGCGCCAACCCTCACGAATGTTAACCTGGAGGATGACGAGTTATTTGGAGGAAATCCCACTGGTAAAGTG
CTGAAGCCTACTGAGACTGTAGGTTCACAGCCGCGTCAAACACAATCGTCGAACTGGGAGCAGATCGGTAGCCATGAGCAAGATGAATTTCTGTCGTGGC
TCGATAACGGTGAGTCTTCACAAGCAACATCAGCAGTGACTACTTCCATTTCTGAGGCGCCAGTGCCGTCTGTGGACGTAGTTCCTCCACCTGCTCCGAT
ACCTGTTGCACCTGCGGCCTCAAACACATTTGACAGTGTTTCGCTCGATGACAACGACGATTTTGACCGCATGCTGGAGAATGCAAACACTCAACCAAGC
TCAAGTGCACCTACTCCAGCAATATTTGTTCCTTCAAGTACTATATCTCTGGATGATGATAACCTCGACCGCCCTAGCGTGCAAGCTAGTTCCTTTGCAC
CTGCTCCAACCCTAGCAACTACATTTAACAGTACTTCGCCAGACAACGATGATGATGACCTTGATCGGATATTGCAGACTGCAAACTCAAAAGCAACCGA
CTGTGTGCCAACAGCTCCAGTAAGCACAATCTCGCTTGATGATGATGATGACCTGGAACAGATTGTGAAGAGCGCTGGAGCTAGCACTTTCGTTTCGACT
GTTTCAGTTGGCAACATCTCGCTTGACGACGATGACGATGATGATCTCGAGAAGATTGTCCAGAAGGCTAACAAGCAAGCAAATGCAAGTAGCTCGCGTG
AGAACAGTGGCTCCTCTTTGCAGATCAAGAGTCAGGTCCAAGCACAGCACAAAACCCAAGTCGGTACGAAGTGGAAAATATTCCCATTTTCTTGATATGA
AAGTGTTTGACCATGATCTTTGTTGTGCTCGTTCCAGACGTGACAACCGCACGGCATACATTCCTCGAGACAGGGGAGCTTCCGGCAGGTTCTCGCCTTG
CGGTGTGGCAACGTGCTGTACAGGTGCGAAAGGTTTCCAACTCGCGCATGTCTTGACTTAGCTCTTACATTTTGTGTTATGGTTCGCGATAGCCTGGAGC
AGAGGATTCGGCATCGATGTACGCGGTGCAGACGACCTCACGCTCACTACCAAGTCAAGCTCTATTGCGTAAGGAGGTGGAGGCTTTGTGCTCACGCATT
TTTTCGAGTGCGGCTCACGGACGCGTCCTGCGCGAAGTGGGTGACAGCATGCGTGGCACACACTTGCTCTTCATCGACAGCGCCGAAACGCTGCTCACTC
ACCTTTGTACTCAACTCGACATTGACTACTTCTCGGGGATGGTGCTAACTTTCGCGCCGTTGCTAGTCGCAAGTGGTAGTGAACCATTGCATCCTGAAAC
TGTGGAGACATTAGCAGCTACGTGCCGTCGATTCCTACCACATATTGGTAAGAAGATTCACCTACGCTCTTCAACCACAGGTCGACGTCCGCTACTTAAG
CGTATGCTGCTCTACCATTCACCACGTCTTGCATCCCATTTGAGTGAGCACTTTCCGACGTGGAATCATGCACCTCCTGAGGAGTATGATGGAACTAAAG
GTAGTGGTGCCATCCCAGACTCGTGGCTTTCTTCTTTCTTTGAAGGTGAAGGAATCGTAAGTGACCCTGCAAACTTTGACTTCCTGCTCAAGGTCTGGGA
CTGCAGTTTGATTCTGGAAGCTTTTACTTCGAAGGAGAATGCACCCCTTACGACTGGCTGCTTTATCACGTTGTATGCTATCATCAGTGCTGAAAAATCA
TTGATTCGAATGCAAGGCGAACAACTACGCCACTGCATGGCAACGACTATCTTGGATACATTATTGCGCGGAGACGCAACGAAAGACCAGGTATTCGTTA
ATGGTATTTGCCACTTGATGAACGCGACGCCACCGTGCATTTGCGCTAGACTCCGCAGTTTCGGCGTGCCACCACCTCCTGTAGTGGAGAATGATGTTAC
AAAGCCTAACGAAACACAAGCATCAGGTGCATCCAACGGCAACTTTGGAATGAACACGTTGTTGTCAGCGTCAACGCAAGGTTTGAAGGATGTATCGAAC
ATGATGATCGATATGCCAGTGAAATTGATGATCGACATGCCGGTGAAGCTGCTCACGATGGTTCCGCTGAATCCCATGGCAGCTTTGTCATCGCCGACAT
CCAATTCACTGACGGATTCCCCAGAAACACAGCAGCTCTTTTATCTACACGTGCAAGCCATGGAAATAGCCTCTGTCGCAGTGACACTAGAGGCTAGTGA
AGTAATTCCGTCCGTGTTTGGAGGAATTCAAGGACACGAGACTGGATCACTTCGCTATTTCATCGTTGACTGCCGTACACTGGAAGAAATGCGTCGCGGC
CAAGTTCCAACTGCCTTCCACTTTGATCCAGATACTATCTCTGACCCTACTGTGCTCGATCATGTTCTCGCAACATTGGGTCCTTTGAAAACTGCTGGAG
TGCACGTATGCGTGATGGGGCATGGCTACGCGCACATTGCTGAGGAGCTGCGTCAATATCAGCAGAAACAAGGAATATCGTCATCTTCGCCATTCTCGTT
GAGCGAAGAATTCCTTGAAACGTACGCAAGTGATCAATCGCGTGTTCAATTCACCATTAAGTTCTTGCTGAAGCACGAGTTTCCACGCGTAAGCGTTCTT
GATGGAGGTTACTCTGCTGCTCACGGTCACCTCTTCCGATCTCACAGCTTGACTGTGGACGATCTTGCAGACCACGACACCCCCAACTGCAAGCTTTGTC
AGCATGATCGCAGCATGGAAGCAGTGCTCCCACCTGTCTTTGCTGGCACACCCAGGGTCGAAGAAAGTAAAGAGTCTGTGCATGAACATGATGCAAACGC
CCGGACTGGAAGCTCAAGGACGAGTGAGACATCTTCGCATCACTCGAGCACTGCTATGGACGACTCCGTCTTCACGGATATCAATCTGTCTCCTGCCGCT
ACTAGCACGAAGAGCCCGCCTGCTGGTTCGTACTACTCAAGCTTTACTGGTGCCTTCAAAAGCGGCGGAAAGACACTCTTGAATCCGACTATGGACGGCA
CCAAATGGCTTCTCAAGAAATCTGCCGCCACCACCGCCGAGTTTGCCAATGCAGCAGCCAATATGAGCAACATAGCTAACAAGAACCGAACGGGGAGCAT
GCAAGGTGCTACTGCGGCTAGCAAACCCTCCACAATTCCCGCGAAGGAGACGAAACAAGCAATGCCGAACTTGAACAAATTACGAAACTCGCTGGTTGCA
ATCGGATCTGAAAGTCTTGATATGCTCAAGAAGGTCGAGTCTGCGATGGAGCATGCTGTCGAGCAAGCCGCTGTGGCGACGACGACGACCACAGCTAAAG
TACGGGTGCCGTTTCCTTCAGCTCTGTCGCCATCCACGAAGGAAACAGGGACTGCTGCATCCCCTGCAACTGCGAAATCGCCCTCTGTTAGCACACCTCC
TGCTACTACACCACCTGCACCGCGTGCTTCTCTCTCAGCTGACCCAGCTCACAGCAAGTTCTTCCACCAGTCGACGGATGAAATGTTCACGATCGATGAC
GACGATGATGATGAAGATAATGAGGGTCATTTCGTTCAAGATGTTGAAGGAAGTGAAAGTCGAACATCGGCAACATCGAGTTTCGCGAGGGATTCTCCCA
TTGCTGCTAGCATCAATGCCGGACCTGTTCACGACGTTAACAAGGGCCACGTGAGTGAACTGAAGAAGGGCATGACATTGAGCCGTACGCAGATGCTACC
TTGTGTGAGCAGCCCATTCTTCGCATGCTACAAGAAGAAGGCCCCAACTGGAAATGGAGGTGCTGCTTCCCATGCCAGTATGCACCCTCGACGCGTTGTT
GTGATGGAGAACCATCTTGTAGTACTCAAGTCGGCTACGCGCAACGAAGACGACCTATTCATCGTGAAATCGTGTCACTCGCTATCGCACATTACACGAA
TGACCTGCCTCAAGAAAAATGCGCTCATGGTCAGTATCTACTACAAGTGGAAGGCTGACGACGGGCAAATTATTGAGCGACGTAATTCCTACGAGGTTCA
ACAGCGTGACGACTTCATCAAGGCCGTCAAGACCACCATGGACAAGATGTAGCAACCAACGCTTGCCAATGCTACTATCCAGTGTTATCACAAGAGCTTG
AAGGTGCTGGGTATCTCTCCTCCATATAGGTTTCTCAAAATATACACTCTTTAGCATGCGACGATGCAAGTTCGGAGGCCAGTTCTCGATCTTCACTTGT
GCTTTTGGGATTAAGGAGCACGTGCCATGTCAGACAAGAAGCGCGAATCACTTGCGTCGAAGATTGATGAGGTTGCTCGTAACCAGATCTGGCGCGAGCA
GCTCAAAACCGAGTATGAAATGGAAAGTGTGCTAACACTGTTCCAACTCAACCCGAAGACACGTACGTGCTGCTCTGAATGACTCTACCCACATCATCTT
CGTAAGATCATCATGTCAACTCTTCTCTTGCTGAGCAGTGAGTTCAATCGCCCTGAAACCCACACAGACCCACCCAGCAGACTTTGGAAAAGCACAAGAA
GACAATGGCACACGAGAACTCGCCGCAAAACTGCGCGCTGTAACAAAGAAACCCACAGAGAAACATGCTCAACCGATGACAGAAGCTCAGCGTGTCGGAT
GGCTTCACGAGATGGCAAGTAAGGGGATGAGAGCAGACATGAATCAACGAATGTTTAAGGGCCGTGGCAGGTACACACATAAATTCTTACCTCCATGTTC
CAATACGCTCGTTCTTACCTTGTCTGCCATTTTAACCTTGCTCCTTTCTAGCTGCGACGTCACCAAATTCGCCGACACGTACTGCACCATGGCAGGCTGC
AGTCCATTTGCAGATAAGTCGACTCGCTGATGCAGGACTTCAAGGAGCGAGAAATATTATACCAACACATAAGAAAGCCCAAAAACATATTAAAGCCCTC
CTTTCTCCGTCATCTCCCCCATCAACGAGATCCCAGTATCTCAACCATTTGTTCTTGCTCTTCACGTCTTTTGGCACTGGTAACTGCTTCGAAGAGAAGA
GACGAAGACGGCAACCGGAGAGCTGTCTACCTACACGTCCATCGGAGGGGGGGGAGCTGTAATTGATCCTCGTCGCTCTGTCCGATGAGGAATACCCTCG
GCCCCTGCTACAGAAGCGCCAGACGCACTAACAATACTGGACATTGACGACTGCTTCGTGATAGGCGGGAGCATGCTTAAAGTCGGCGATGAAAGTGGTT
CCATCCCAGCAACCTCCGCGTTCTCGTCCAGCAGCATCAACTGGTTGCGAAGCTCCTCGATATGAGAGAGCACCACACGTCGATGACCTTTTTTCACATC
CATGTCAATAAGGTCTTCCTCATCAATTGTAGCCACACCACGCAGCGTATCAAATCCATCTTTCTCAAAATTCTGCGCATATTCTTCCATTTTGAAGAAC
TTGAGCCAATTGTAAACGGTCTCAATATCTGTGTACCAATGAAAACCAACAAGCAGTGAGACACGAAATCAAAAGGTATGTAAACTCGAAATATGACATA
CTTCTGGTCCGCGGGGCAACGTTTTCCTCTTCGTCACCTACAGGGCGACCGCCATCGTGCTCTAGCAGTGACGTTGACGACTCATCGTTCGTCGAATAAT
CGTCGTTGCCTTCCTCCCACGCTAGCAAGTAATTAGCGAGGGAGCTGTGACCGGCCTCAAAAGCACAGCGCGACGGACTCTTGTTCGTCTACAACAGAGT
AAACACGTCAGAAAAGACATACCAGGCACCTCGCTTCAACAACGCGATATAGCAGATCACCAGCTCTAACCTGTGTCAACGAGAGGAATTCTGATGAGTC
TCGCGCCTTCCGGATAAGCCAGAAAGCGCACTCCTTGTTGCCGCCAAGTGCAGCACTGTGCAATGCATTGCGACCAAACTGCAATAATATCAACAGTGTT
ACAAAATCAATTTGTAGGAGCTATACTCCACAAATTTCCGTACCTTGTCGACGTCCGTCCAAAGAGTAAAGTGCTCACTCAAGAGCTTCAAAGTCGATAA
ATGACCGAACTCGGCCGCCCAATGCATTGCGTTTTTGCCATTCTAAAACCACAAAATTGCATTTAGCTCACGCCAGACACTTTCAGTTAATGCACCTCAA
AGTCATTACCTTATCTCGCATAAACCGCAGAGGATATGCTCCATTGATCTCAGCAATAATCCGCGCGATTTCTTCATCATCGCCTTCTTCAGCAGCATGA
ACGAATTTCTGCCCGCATTACAACAGATCCGTCAGGAATCTCACGACAACGCATTTTCCAACTGCAGCGTGCCATACCTGCGAAGTTTCGTACCAGGTCT
TCAAAAACTGCACGCACTTTTGCTTGTGTTTGTCCTTGGCAATCTGGTACGCCGTCTTGTTGTCCTAACAACGTCAAAATGTCAACATTAAAATCATCCA
AACCACCACAACCAAGTACGCACATAGCTGGTAATGTGGATATCAATGCCCTTCATACAGAGGTACTGAATGACCTCCTTCCTTCCCTTCGACGCCGCCC
AGTGTAGACACGTGCCACCATACTACACACAAAATGCGTGTCAGCATTCCTCCCTTTCTCCTTTAGCAACTGAACACACCTCGTCCACTGCATTAATATC
AATGGGACTGGGACACTCCTCCAGCAGATATGCCACCACATCCAGATGTCCATTGATCGCCGCAGAGCAATGCGCCAATCGTCCGAACTTGTCGGGTGCG
TCTAATGGCACTCCATTCTCCACTAGGAACTGTACAACCTCGAGATGACCGTAGAACGCAGCATAGTGTAGCGCCGTCTGGTCGTCGTGGTCTGTGGCGC
TCCAGTCCACGTTGCAATGGGTGCCCATCCATTGCACCACGTCCAATTGACCGGAAGCTGCTGCTGCATGCAGTGCAGAGCATCCATGCTGCAAATAACA
AACCACAGAATACCGTTAGTTGCGCTGTATAACGGACAGTGTCTTATGTGCGTTGTAGTGACCAACACTCTGCCGTCTTGCCTGGTTGCGGTAATTGACA
TCAGCGTGCAGCGTCTTGACGAGGTGCTCGACCTCCAGCAGCTTCCCGCGGTTGGCCTTGCAGATGAGCACGTCGCCGAGCGTGTAGCTCTCCACGACGG
GCGGGGCGCTGGCGCCCAGCGGCAGCTGCAGCACGCGGTTCATCAACAGTCTACTGCGGAGCTGCTCAGTGATATGAGTGAGGGGCAAACAGGCGGGTGG
AGGTTGCACGAAGGTCGCGACAACAGCGTCGCACCACTCATTCACAAGAATGTTGCACGGAGGAATGACAAAAGAGGTGTATAAAGCAATATCATTCCAC
ATGGCAGGCAAGAATGCTACTATGCTAACTATCTGCTATGTCTCTAGGTCTAGGAGTCATGATGGTGACGAGATGATACCATATGCAAAGTCCCTAACTT
GTTGGTCATCACGGATTCCTTCGATGGTGGCGGGAAATGGCTGCATTTTATATATGCACATATTGTCACTTGCAAAATCTAAAGATAGCTTGAAGAGGCG
CAACAACACTACAGACTCGTATTGCGACCGTGCTATCCAAGGTTCCTGGCGCTATAGATCAAGCATGGGTGCCGGTGCCTCGACCGACAACACGGGCGAG
GTAGCTACCATTCTTGTGTACTCCAAACTCTGCGTCCTCGTAGCTGAGACCGTACTTTGTTGTTGCCACTGTAGATCGTAGTGGGGGATGTAGTAACGTT
CCAAGTGGAAGATCATCCGAAACGCGTCGTTGGAGTAAGCACCAGTCGTCTAGAAGCAATGTATTGGAGAGAAACAATTGACCATTGTGCTCTGGTTGTT
GATAGATCGTGGCGGACGTGCAAGAGGACAGCTGCAGTATCCAGGTGTCCAATACGGAGGTGCTAAACGGCATTCCACGCAACGATGTCAAGCGAATTGC
CAAGTGGAATGAGATCGAGGTGGGCGACAGGGTCAAAGTGAAGGAACAGGGCTCTCGTCTATATTATGAGGCCGAAGTGGCCGCACGCAACGAAGATGGC
ACGTACAAGGTGCACTTTGCAGAAGTGGACGAGGAGGAGGACAATGTCGCGGCTGACAGAATGCTCAAGCTGATGTCTGGTCGTCTGGAGGACAAGGAGT
GGATGATGTACAAGGAGACAGAATAGGAGTAGTTAATACATAGACTGCTGTATTTTCCATTGCTTAAAAATTCCCTTCAGACGTGAGAGGATAAACCATC
GTGTACCATACCATTGATCAGACGGCAGGGTTCTCAAGTTTAGTGTGACGCGTTGGTGAAATAACACGCATTGTTTCCGACTAGATTGTCTTTGCTAATT
GCAATAGGGAGAGGAAACCTCCCTTGGGTATGTCCACAGGACTTCCTACATGCTCTACTATCCACTCCTGCATTGAACCAGAACGTTAGCATGCAGAATT
GCCCATGCAAACAGACAAAGACTTACCTGAATCCTGTTCTCTATATCTTCTAAGCTATCTGTGCGTGAAAGTGCGATAGGCCCGACGACGCTCACAGATA
ACGGTTCGGTACCTTCAGGTGCATCATCCGGAAGTGGTAGAATCAGAGGATCCCGCAGCAGTAGCCGAACCATAGCTTCATTTTCGTTTGGAAGTAATTG
TGCGAACAAAGCTTGTCGACGAAGCCCATGAAGGATAAGATCTACAGCACCAACAACGACCCCAGGATGTTCCGCGTATTAATACTAGACCAACACGATC
ATCATTTTCCAAACGTACCATCTAACAATACCGTTGAGAGAGTTCGTAAGCGAATTGTATCATCGGCGTATTCGTACACATTGTCCGCGAGCCAACGGGC
AAGGCTATGGAGCATGGGATCATAGAATATACCCTTCTTCTCCAACGTTCCCATAGTCTGATCGATAGCATCGGATACCAATGGACGTGCAAATTGCCAA
GCAAACAACTTTTTGCGCATGACCTGCTCGCGTAGCTGCCTTTCAGCTTTCTTTTTCTTGATGATCTCTTTCCGGCGGTTTGCCTCTTTCGTCTTCTCCT
CCAACTCACGCTCTGCCTGTTTCGCATCACTTTTATCGGCCTTCAGCACCTCATGTTGATAATGTAACGTCTGCATTTCCTGCTCTTCCTTCACTTCCAC
CAGCGCCTGTGCGAGTGTTTTGTTGACTAGTACATTCAACAATGGCTTCACCTCGACATCGAAGTTAAACAACCCGTCGGACTCTTCAATCTGTAAAGAT
CACAAGAGAAACAATTTGAGATGAACGATCAAAACTGCAACAGCCTGCAAAAATTCTAACCTGTGTAGAGGTATCGATGCCAATCTTTGGTCTCAGGAAA
GTGTCATTCGTCGTTGCATTTCGTGCGTTCACAGAGCGAGTCACGAACTCGTCCGTTTGGCTAAAAGACTCTCGTTCCAGTGTCGGCTGTGTCTGTTCTA
TCAGGTTTGCCTCTAACGAGATCGAAGTGACTATGGCAAGAAACACACTACATAAGTCAGCAGCTTACTCCAGCAACAATACTCCGTCTTCCGTACATCC
GTATGACGGCATTGATTGCGCTTCAAAAACGTTCGAATGGCTCTTATTGTTGTTGCTTCTCTTCTTGATCGTTACGCTTCTCCTCTTCTTCACTTTTTCC
CGTCCATCTATTGACCTCGCAGTGTTTGCCTGCACAAAACCAATTAGAATGGGACTTGTGTCAACGATTCTTCCTCAAAACCCACCGGTGCGAAGACACT
CCCGCGTGGGATCCTTGGATCGTGCATTATATTCGGTGGGATAGTCTTGCTTCCATTCTCTCGCGTCTTGCCGCGACTTGTCTGCACTGGTCGCGGCTTG
GACGAGTACGAGTACGACAAGTCCTGCTCCATCTGCAACAGATACAATAATGGGTCAAAGGTCGGAAGTTGAAGTGGCAAACATAGATGAAGGCAGTACC
GTAGTCGTACTCTACGAAGTACGACAGTACCGTAGTTATACTTCACTAAGTACGATTATTCAACAACGTGAAGAAGCACAGTATTTCTTGCTTGTTGCCC
TTCCTGGCTCGAAGACATGTCCATCTTCTACTGCGTCGTGGCCAATAGTCACTGTCCTTTGGCTGAGCACAGCAACGGCGGTGACAAGAGCATGAATGAG
TTCGCGCAGAAGCTGCTGAAGAAGCTTAATTTGGCCGAGGACGCAGTCGAGTCCATGGACTTTGATGGGAAAACGTACAGCTATCGTGTGGACAATGAAG
TGGCTTATGTTTGCGTCACCAATGCGGCATTCGGCAAGAGGTGTGTATGCAACAGCTGATAAGATAATTGAGATCGTGGTGCTGACGTATTGGACGATGC
TTTGCAGCTCGGCGGCGCTATTCCTCAAACACATCAACCAGCTCTTCGACAACCAGTTCGGCATTCGAGGAAAGGCTACGAAGCTCAAGCTCGACATGAA
TCGAGATTTTGCACCGACATTAAAGAAGCAAATGGTGAGTGATGGAGAGACAAGAATTGAAGCAATGCTGACTGTATTGTGTAGGAAACGTTTTCATCGG
ATAAAGGCGCAGAGAAACTGCAAGCGCTGAAGAAGGACCTGGACAATGTCAAAAGCAATGTGCAAGAAAACATCAGTACGTTGGAGGTGGATGCTTGATG
TGAATATTGAAGACGATGCTAACGGGGTTTCTCTATGTCGAACAGACAAAGTGCTGGAACGGGGAGATAAAATCGAACTGCTAGTGGACAAGACAGACCA
ACTCAAGTATGCTTCAGCTGGTTCAGAAAGGCATGGAGTTTATGCTGTACTGACTTGTTATTTGTTGATGTTTACAGCTCTCAGTCTGCAGCATTTGCCA
AGTCTAGCACGAATCTCCGCCGCCATTTATGGTGGGAAAATGTCAAGATGAACATTGCGATCGGAGCAATAATTCTCGTACGTGTATTTTCTTGTTAGGT
TGCTCTAACGAGGGTGTATGCGGATAAATACTGACTTCTTGTGTGTTCGCTACAGATTTTCGTCGCCCTTATTTTCCTGTACTTCAGAAGCAAGGTGACT
GGAAGCGGGGACAAATAGCTAGGTATGGCGTATGCATTGACCAAGGCGCAAGTGAAGTAACACCAGGAAGACAAAGATCTATTATTGCGGCGGTATCGAA
CGCAGCTCGACCAGGTAGTGACAGAACAAAATGCCAAGCTTATTGCACCTTGAGCTTTCTTGCCGGACTTGATTTGGTTGATGAGGTCAAAACCAGTTTT
TCAGCACATCCGGTGGCGACAACTAGAACAGCGGTGCAACCGTAATAGAGCTGGGTACTCGTTAGGTAGCTTGCACCGCCCGTTCCGAGGACCACCAACA
CGTTCGTCGGAAGCCGGAAAAGTGCGAGTGTAGTGCTCAACTCGTTTTTCGGGAAATAACTACTGCGGAGAGTTGCGCAGCACGGTGAAAACAGTCCAAC
GCAAACCTTTTAAGACAAGATCCATATTGTAAGTTTTTGCAGCATCGTTCAACATGACGCGGTATTGCCACCTGCTCACCTCAAATACCAAAAATCCCCC
AAAGACGTAATGGTAATCTTCTGTAACCTTTACGCACAAGAACAACATCACTAGTCAGCTGGCTGCAACGACCAAGGACATTAAATCCACCACGTCGAAC
CGTTGGAATTAGTAGTGAGACCGCAGAAGCAGCAGCAGTAATCACCAGCAGGAGTTCTTCACGGAGCCGCGAGCTGTCAACTAAGTCAAACAGCTTGCCA
CCAATAGAAATGCATAGCATGAAGCTCGAAAACACGAGACCACTGGGTAATTCCCTATTGGGGACGACGCCTTCAAGCGTTGGGTACCACAAAAACACTG
TACAGGGAAGCGCACGTGAGCAAGCGTACACATATACGACACACATTGTGACGCTTACCAAACACGTACATCGCTCCTTCGAAGAGCGAGTAGCAAAGCC
CTAAGGCGTATGCATTCACTAGCAAGTTACCGCTATTTTTCACCACGCTGTCTTCAGGAATACCAACCTTTTGAGTATCATCGCGATCACTCTCAACAGG
TGAGCCATAGTTTTCAGACCACGAAAACACAAATGAGGCCGCGATGGTCGTCACAACCACCGCAGCACGAAAGGGCCCGATATCTCCAAATGTATCGGCA
GCAACCTGTGCAACAAGCCCTGCGATCACAGCAGCAATTCCGTTGATCTCGGACCCAAGTGCAAATGTCTTTCCAAGTAGACCTTCATCAAAACCTGGAC
ACAAATATTGATAAGCAACCTTTTAATCCCAGTAAGCAGAATCGATGTCCTCACCACGTGCTCGATGCTCTGTGACCATCCAACTCTCAAACGCCGAGAA
AAGTAGTGATGTCGAAATTCCACCAAGAACTCTTCCAACCAGTAACACTGTCATATTCGGTACATCCTCTAAGAAATTAATGGCAATCTGTATGACAGAA
GGTCGTGCACCAACAACATTAGATTCAGACAAACGGTTAACAGTCTTGCTCATGATCAAGACAGCTTCATATGGCCGACCTCTAACACGCAATACACCAA
GCAAGCCTTGCGTCTTCCATACTTGTCCACTAATGGCCCGACAAAGTTACCAAAGACAAAAGAAGACAGAAAACCCGTGAGGAATAATGTGCTCACGTTC
ATTCCGTAGCTCTATCCATCGATAAAGAAAACAAATGTCAGTTGAATGACCACACTTTAATTATTGAAACTTTGGCAAACCTGGTACAGACTGTACATAT
GCGTGCCCTGCAGCCAGTCGGCGAACATGACGAGTCCATAGACAACCAGATACTGTCGCTGGAAGTGCGCAAAGGCTTTATCACTCATATTCTCAATCTT
TTGACGAGTGGATTGCGCCAGAAAGAGCTTCTCGATGACATGCAGGGACAATAAACACACAAGCAATCCAAGGCAGCATGCAGACGCCCACACAGGCCAC
TGGAAGGCTCCATCAAGCATCGTCAGGAGACTATTGTGGTAATGACGTCGGTATCAGATTATCTGATTCTACAATCGCTACTTACTTCACGGTACTTCAT
GGGATTACTTCATGACTGCAACAATGCATGGCTGGTCACAATAGACTTGACGATGGAGGTGCTCAAGACGACGGCAATCAGCGAGAAGGCGGCGGCGAAG
CTGCTCAAGAAGTTCGTGGACAGCAAAGAAGAAGAGGAGAACACTGATCTGATGGTGCGTTAAACAGTGTAACTGCAACGAAAAGTCCTTTGGCTGACGT
TGTTTCCATCAGATGAACGAGGAGGTCAAGTTCCAGTTGGCGCAGGTGCTGGCGCACTTGGAAGGCAAGAAGCCGCAGATTCAGCAACAACAGGACGAGT
ACCAGTACGAACAGTACTAGGCCTCAATATGTAATACACGACACACGCACGTTGACGATAGTGGAGGCAATTGTTGTTCGGTGGGGAATTTGCGATGGAG
GCGCAAGTTCCCTGAACAGTACAATGACCTTGAATGTCTTTGATTGTACGCAGCGCCAGGCGACAGCGCGTCTGCCGCATTGACGACCAGTAGACCAGCG
TTGTTCGCTGGTCTGTATGCTATGCAGACACTGATCTGTATCCGATCTGCTAAAGACTACTACAGTTCAAGCTCGACGAGTGCATCTTGATCAGACTTCG
AGCAGGCGACAGGTAGTTTAGTGCTTGAAGTGCTGTCAGCATTTGTCACAAGGGATTCAGATCGTTAACACGTCGTCATTTCGGCGCAGCAACGACATCC
ACATCGGCGACAATGTCGCCGACACGCCTTTGCTGCTGCTACTTGGCGAGCTTGTAGAGAAACCAATGCCATAGATGCAGCCGAGTCGTTACGTCAAAGA
CGGTAGATCTGAAGTTGGGGCTGAACTCTAGATCTTCTCATCTCCTGCATAGGAAGCATCTTATCCGTGTGCTCTCTCTCGACGGGCAGTACGATATCAT
AACCCAGCATTGCCTACCAGATGCGATCTGCTGCCCTTTGTCGAGCATGACCCACCGTTTGGCTTGCAGTGCCTCCTACAACCTCCAACGAAGGCGTTAT
TACAGCAGGTCGTTCTACACAAGTCTTCATTGTCAGGTGCCCCATGATCAAGGCTGCCAGCGCCTTGAAATTTTTCGTGGGCAAGACCCACGCGCAAAAC
GGCCATACATAAAGTCTAGCGTCATATTACGGCGAAGTAACACGGCGGCGACACGAATGTGCAATGTGCCGTGGCGCCGCGATCACTAACGTTTGAAACT
GTGCAGCGCCCATCAGCGAGGAGCAGCGACTTGGAGTTTACAGGCACTGACCTGCAGCCTGGCACCGTGGAAACAGAGACAGCACTCTGAGCCACAAAGG
TCTCCACATACGGGTCGCTAGCCTGGTCCTTGTGCTGACGCCATCGTCGCGATGGCATTCCGGTCATGAGCACGGGCATTACTCGACGCGTGAAGTGCAA
CAGCGGAGAGGCAGTGGAAGGACCGATTCCAGCTGGCGGCTTCTGTCCGCCTGGTGTGTTGATCGCAATTGCGCTGGCAAACCTTGACGCTACCTCAAAG
CTCAAGAGAATTTACTTTTTGAACCAACCGCAACCGCTTCAGGCAGAGACTCACAACCGCAAACTCCTATCCACAGACAACCACGAACATCTTGCACGCA
CAGACGTCAACAAGACTGTCAGCACTTGAGACTGACTGGTCAAAGGTCAAAATCAGAGCGTTACGGTACTTGGGACGTATCGCAGAAAAGGACGCCCGCC
CCGGCTACCCCCCGTTGCAACAAAGGCAACTGCACAACCTGGAGCGCCCAGTTTCGTCACTCGCGAATTTCGTCCGCAGCCAGCAGCGTCTTATCTAAAT
ACTAGATCTCTGAGTCTAGTACAGATCATCATGCTGGACTCACGCAGCAGCAGCAACGAGCTCGATCTGGCCTACATGCCGTATCATGAAGGCCTCGTGA
ACCACAACGCACCGCCTGTGCGCGGCAGCCTCTCAGTGCGCGTATCGAACCAACAAGCCTCGCATCCGCAGTCTCCTTACTACGGAGACAGTGACGACGA
CGATGTGTCGGACGACCCGGCGTGGATGAATGCTCCACGCGGCAGTCTACAGCCCGCGTTTCCTTCTAGTCTCATGAAGAAGGCGTCCAGCGCCTCCGTC
ACAGACACACAGGCTTCTAGCCCCAAGTCGCCGGGTACGGACCCCATCTCCAGCGCTGGAGAGGAAGACGAACAGGAGAAACAACGCAAAGAGAAGAAGG
ACGAGGACGAGGATGAAGATGACGATGACTACTTTCCTCCTACGATGCCTAAGATGAAGTCACCACCACCGTCGCGTCAGAAAAATTCGAGTAGTGGACG
TCGCAGCTTGAACAATAATGTGGATGAGAAACTCACTACGGACCTGAAGCTACGCAAGTGTAAGAGTATGCCGATGAATCAAGGCCCTGCCAACCCAACG
GATGCCAACTTGATGGTCAACCTCGGAGTGCCACGCAATTCGCGCGGCAACTCGGAGATCGACCGCTTGTCGGTGGAGAAGAAGTCGTCAGACTTGGACG
AGGACTCACCTAAGAAGAATCCCACGTCGCCAGCGACGGCCGGTAGCAACAATGGATATCGTGATAGTATGATGCGTTACCGTCCGAGTGATCTAAAGCC
GCAGGATCTCACGACAGCTATGATGTCGCGTGATAGTCTTGCCCCGGAAAATTTCGAGAGCAGCCGCAGCAGCAACATGGGCTTTGAAAGCAACCGCAGC
AACGACCAGTTCGGCAGCAGCAGAGATAGTAATGTGTTCGACAGCAATCGTGGAGTAGATCCATTCGCGAGCACTCGAAGCACAGACCTAATGAGTGGAC
GTGGTTCGGTCATGCACTTCGGTCCGCGTGTGACGGAAGAGGGTCTCTCTGACTACCTTCGGGCTGTGAAGACTGGCAACCTTCAGGTGTTGCGCTCCTG
CTTGCAGGACAGGAACACGGACTTCACAGAGCGAGATCCAGTGCACGGCCAGTCTGCGATGCACATTGCTGTGCGATTCGGCCAGTTGCACGCTGTGCAA
TTGTTGTGCGGTAAAAAGACACGCGGCCTGCTGATTGATGCCGTAGACAACAGACAAAACACCCCGTTGCACCTGGCCGCGGCTAAGTCGCGCCGGATAA
CCAAGTACCTGCTGGAACACGGTGCTGATGCCTCGCGCGTGAATAACCGGAATCAGACGCCACTCGCTGTGCACATTATCACATCGAAGCGTGATGATCC
GCTGATTGCTGAGATGTTGTTACAGCACAAGACAGACCCGAACGGCCCTCTTGGAAACAGCACTCTACTTCACAAGGCTGTGGATCTCAAGTTCTTCGAG
ATCGCTTATCGCCTCGTGCGCCACGGAGCTCGGCTTGACGCGAAGGATGCCCAAGGACGCATGGTGTTCGAAAAGGTCGATCGCAAAGTTTTGCGTCAGC
TATGCGGCAAGATCTCATACCCGCCTGTGTGGGTGCCCAACGTGGAACGCAAGGGTTGCATGATCTGCTTGCGAAACTTTAGCCGGCTTGGTGTCGGTGT
GCGCCGTCACCATTGCCGCCACTGCGGTCGTCTTATCTGCGGTCGCTGCTCGCACGTGTCCGTGGAGAGCGAAGCGTTCCCGCCCACCTTTATCGGTCAC
ATTGACCGCAACCCGTCAGACGAACGTTCGAACCTGAAGCGCGTGTGCAAGACCTGTAGCAGCGTGTTTGACGAGCGCGCCAAGCAGACCAAGGATGGGT
CTCCTGGGAGCAATCGCAAGTGGTCAGACAACTTCATGGATCGAGTAGTTGGCTGCTCCTGGGACGAAATCGAACGCAAGGGTAGCAGCAGCAACCTCGG
GTCATCTCGACGCGGTTCCCTCGCAGCGTAGGGACAAATTCTCGGCACCACGGCAA