Description :
From Genome Similarity Track
Location :
Scaffold_4135:116- 1486
Sequence
1370 bases(100 bases per row)
TCACGGGATTGCGCTGCGAATCGCTCCTCGCGAGCGGACTTCGGTTCGCGCTCTTGGGACGGGTGGATCCGTCGTCATCACTGACGGTGTTCCCTTCGAG
TGGCGTAGACGAAGTGTCCGTGATCAGGCAGACCTGCTCAACCTCACCAACCTTGAGACCACGAAGGAAGTTCTTCCAGGAGAGACCTGAAAGCCGGGTG
ATCGATTGAGCGTCGCGAGGTGGGCACGCAAGATCGACGGTGCGCTGACGGCCCATGCCGTTGTCCACGTGCTCAATGACACAGACCGACTCCGTCTGTG
AGATGCCGTTCGGTGCAGTTTCACGTCGTGGCTTCAAATGACGGCGCTTCGACTTCTTTGCCCGGCGCCTCGAGTGTGTACTCGAGGAGGAAGAATCGCT
CTCGCTGGACGATGTTTCACCCCGCTCTAGGCACTGAAGCTCACTCTCGACTGTGCCGGTCACACGCGGGGGCCACTGCTTGACCGCGTGGTCGTTCGGC
GGGAGCTCCAACTGCTCGACCACCGGCTCGGGTGACGGGAGCCTCGACTGCTCGACCGCCGTGTTGCATTGCGGGAACCCATGCTCGACCGCCATATTGT
GCTGCGGGAACTCATGCTCGACCGCTGTGGTGCGCCGCGGGAACCCATGCTCGACCGCAGTTGTGCGCTGCGGGAACCCATGCTCGACCGCTTGCTCGTA
TTGCGGGAGCCCCTGCTCGACCGCCATCGTGTTCTTGCCCTCGCCTCGCGGCGAGGAGCCTTCGTGCAACAGCACTGCGCAAGCCGTGCAGAGAGGGCCA
TCGCTCACTCTGTGTCCAGCCTGCGTCGTGGACGACCGGTCCACGACGGTGACGTGGGGCCAGTCCTTCTGGGCAACCAGGAGGTGGGTGAACACCTCGC
TCACGTCGAAACCGCTGCGGTGTTTAACCGAGCAAGCCAACCAGACAATCTCTGGTTGATACCGTGACAACCACGGGATGCCCAGGATGCAATCGAATGC
GTAGTTCATCTTAATCACGAGGAAGTCGTCATTGCTGCGAAAGCCGTCGAAAGTGTACGGCAACGTAATCTCGCGCCGCGCGACGTGGCGCGGCTTTCCG
TCAGCAAGCTTGACTACAACCTGTCCGCGACCGTTGCGGACAGCGATTTCGCTGGGTAGCGTCGACAAACACGACTCACGGAAGAAGTTGTTTGTCGCTC
CTGAGTCCACAAGCGCGCGTAGTGTACGTCGGGCGCCGGCGACATGCGGCTGATGATGATCAGTCTTGAGTCGCCCGACGCTGTGGTGTCATTGAAGTGT
GCGTGTAGCACGCGAGGCTAGAAGGTTGAGTTGCCACCGGGGGAACCCGGACCTCAATCCAGCCAGTAGG