Description :
From Genome Similarity Track
Location :
Scaffold_891:116- 13178
Transcript NameFunction/comments
Phyag_g8577hypothetical protein PHYSODRAFT_248212
Phyag_g8578hypothetical protein PHYSODRAFT_248130
Phyag_g85792-isopropylmalate synthase
Phyag_g8580hypothetical protein

Sequence
13062 bases(100 bases per row)
ttccttacatccatagtagcgtgagcagactgaagtgtcgtccatcgagtgaggtgtcacgacgctgcctccactctatctcATCTGtcaaaggttgtat
agcagcttccctaaccagctcactgattggtcaaaataattccggggacagcgtcaggaagtggtcaagttggtcaagttagtccgagtggtcagacgtg
gtcccgggaagttccccagtatctttaacaaaccgtCGCATGGGGCTGAcgccgccgttgctgcttgccgaCGTGTGTGTTGGTGTTTGGGAGGCGGAGC
GACTCTCGCTGTATTCCTCACGTGCGCGCTCCAGAATGTGCCGCTTGATGTCCAGGAACGAGTCGATGATCTCGTCTTGCACGAGCTGTTCATACAGAGC
AAACACTACTAAGAATCATGCATTAGATGCAAGAATTGGGGTATTCGTACCAGTGGACAACTGTGTAGAATGGACATCATGTAGAAGCCGAGGTCGCGCT
GCCGCTTGTCCACAAAGTCGGCCGATAGTGACGAACCGATGTACTTCTTGCTGGGCAGGTACGGAAACAGAGCGGCACGCGACGGGTActtctcgcgcag
cttcatATGCACAACAAGCAATGCATTCGTTAGCCCCCTGGTGGCCAATTCGTCaagcgagcagcttcttggtctcTCACCAATATGTCGATTGCGCAGA
ACTCTCGATAGCGGCGTACGACGTCCCAAATCTGCCCAACATTCATTAGTACAGCCAATGCAATGCGGTGGGCTTACATTCTTGCAAACCTCGGGCGTTC
CATTGCTCTCGatccacgagcagcgcagAATGTATTCCTGTGAAAATGAAAGACGTAAAACATTAGCGGCAATCACTTAGAGCGGGTAGAGCAGGCCCCC
TTACCGTGTAGAACTTGCCGCAGTCCAAGTCCAGAGACTCTTGGCTTCCCATCACTTCCACGCGGAAGTCTCCGTGCAAGCTCGAGCCGCTGCTCCGCGG
CTGAAGCTGGGGCGAGGCCATCTTGAGCTTTATTGCGAGAAAGCCTATTCTTaggcagaagaagaactgcgtTATTTCATAAACGTGAAGTTGCAGTTGA
ATTGACCATCAAAATGATATACTTGGTGCTCAAGCCCTCCCCACAAGATTAGATGACAGCTCTTTACATTATTTTTTTCTCTCGACCGAAACGCAGGCTT
CACTTCACGCATGACAGTCCTTGAAGAGACATCAATCACTAAAGTCGgactcgtccgagtcgaAGGCGGCGGCAGTGGCGGGGCCAAAGATGAACGGCGC
GGGCTTCTTCATTGTCTtaactggagaagacgtaTCGGTGGGGACCTCCACTGATTTGGTCTCTCCCAACGTCACAGTCTTCCGTCGGCTTACACTTGAA
CGAGACGGCGAGGATAGCCGCTCTCCAAACAAGTTTTCCGCTTCCTCGTAGCTCTGCGTGGATGACGCGGGAGAGCTCGGAACTTCAGGcaggttctgct
gctgttgttgccgGTGCTTCTGGGGAGCTGGCTTGATGGTCTCCCCGAATAGGTTTTCGGCGCGAAAttcctcttcgctgtcgcttgGAGTGTCGGACTC
AGCACGCTTTTTCACAGCTGGAATGGGACTTACCTGCAACACTGGAACTGTCGCGGTTGCCAGGTTCGAAGTACTCACAGAAATATTTATCAGTGGTGGC
GCTCTGCTTCGTGCCCTCTCTTGAGGTTCTGGCATAGGCTCTGACGGTTTAATTACCTTGTTCgtggtcaccaccacctcttcCGTGGGGGTGTTGGTTG
GTTGATTTtgcacgacgacagcagctggagctggtaAAACTTCAGAAGCAGGAGGTTGGCAATCCTTGGTGTCAACAACGTTAACAGTTGCGGGAACAAG
GTCGTTGAAGGCGTTTTGAGCTGAGCCAGCAGGGCTTACCACGTTATTGAACGTGATAGGAGCTTTCGTGGTGGCCACGGAGTGCACTGTTGTCGAGGTT
CCAGCAGGGGGCGGAGATTTCACAGCGATATCCATAGATGTTGCCACCGAACCAACAGTTGGCACCTTGGCAACTTTGTTCGGGATACTTGCCTGCAACT
TCTTGAATTCATGCTGTAATGCCTCTTTGTTTTGCAACACGTAGTTTTTGGAGCAGAGGAGCAAGGCATTGCTCTTCAGTATGTCCGGCTGAACGCTCAG
CAGGCACGGAACCAGTTGCAATGCTCGAATAGGCCCAAAGCCCTTGATTAGCGTGTCCAAGTAAGCATGCGAGTCCATGAAATTGGTCCCAAATAGCCGC
GAGTTGACCTTGAACTCTTCAAGCCGCACTTTGTCTTTTTTGAGCAGCTTGCGCACGATCTTTTTGatgttcttctccatctcaacagcagcgttATCGT
AAACGGAAATAACTTCGTCTGGTAGAGTTAGAAAGGCTTCAACAGGAAGAAGGAGTCGAAACGGGTCGATCTCaacctgcttctgctgcttctgtttcAC
TTGAGTTGGCGTTATCGCGGCCACTGCAGAACTATGAGGCAATGATGTTGACGTTTCTCGAGCCAGCAGTGGTGTCACGGCCTCAGTTATGCTGGTCAAC
TCCTTAATAGGAACTCGTTTGGAAGGAGTAACCACAACTAATTCCTTTTGCACCTTTTTCAACTCACGGACTGATGACGACGGCACCGACTCGTGCTTCG
TTTCCACGTTCTCTACCAGCTTGCGGTCGCTCTCGGAGTccatcgtgctgctcgacgagACCGACAAATCTGAACCCCCAGAGTTCTGTTTCTCAATAGC
AGtaggtggagctgctgaccgGACGGGAAATGTCAAGCGGCGACGGCtcggaggagacggtggcgaggctgcagcagtggattTCTTGGCTTCAAACACG
GCGCGCGCCGACTGAAAGGCCGACACTGTTGCATTCTTCTCCGCTCTAGGCTCTAACGCTGCAGTCTGTGTTGGCGTCGCGATCGCTGGAGCATGGTGAT
GAGCTTCAATTTTTGGCCATCTCTTCACGGGGGAATGCGCAGTcttggaagctgctggcgctggcgctggcgctgcgttgTGAGTCCAACGTAGCGCCAC
GCTCTGCCGGATCGGGGAGCGGGTGCTGTTGccaggaggcggcggaggcgacgacgacgccatggtCGAGGGTCACTGGTGCTCTTCTTACGGGCTCCGC
TCTAGCGATGATTATTACTGTAAAATGAGGCTTTGAGGCGCTGCGGCGTAACGGTTTCCGCTAAATCAGCCAATGGGGGGCCGCGCTCCATTTGCGTACC
AGAATGGATACATCCTAGACGTTACATTGCACTCGTATGAGCGCCTGCATCACCGACAGGATGCTGTGGGCTGCTTGTTCCTCGCTAGGTGCTGATCCGT
TGTGCGAGGCGCTCGCAGTGCTGCCGCATTTTGATCGTTTGCCTTCAAGTTCAGGTTGAAGGCGAACATCTGATGAGGTTTGAAGGAGAGGAAAAGCGCG
AGGGATTGGGCCGCACTACTAATGCTGCTTGCTAGCCTACCCGTGCTAAGTGCACCAACTTCGGATTTCTGGCGAatacatgctgctgcacagaTTGACT
TCGCGCTGCAGTATGATGGTATGGGGACGCGACCACTGCCTTTAGATCGCTCGCAATACTTGTATACGCACGGATGTTGCGGCCTGCTACTTTcagtcgc
cagcagcgctgtcATCCAAGTCTTCCGCAGCAGAAGAATCGGGTGGTCCATGCTGCGGATCGCTGTGGGAGTCTTGCCGAGCGCCCGGGCTaatggcgct
gctgggagGAACGTTCCCTCGTTGAACTTGCTCCTGGACCCCTCTTGTCAAagcgcgctgctgtttgctgtcCCGCCATCGCCCGTGTTGAAGCCGCTTT
TGAGGCGTGTGCTAGCGTTGACTCGCCGCCATTCTCGCGCGCGTTCTTGTGGTGGTGTATCGTGTCgcttggagctgcatcaATTAACAGTGGCTGATGC
AGGCCGAAGCACCGGACTAGGCTTTGCCTCTGTACGCCACGAGAATCTTTGATTGGCCGGTGCTCccatgctggtggtgcacgAACTTGCAACCTGCACC
AGCCATGCACGTCTGTTTGAGCAAACGGCCCTAAAACTGCAACCTGCGTCAGCTCCGctcattccgcaatttgATCCGGGGAGCTCAAGTGATCCACCGA
CCCCCTGCCACAGTAGCAATATGATGCAGTCGATCGCCAAGCGCTCGGCCGGCGCCAACGCACGCCGCGCCTTCTCGAAcgtggccgccgccgagGCCGG
CAAGGAGCGCCtcatcatcttcgacacGACCCTGCGCGACGGCGAGCAGTCGCCCGGCGCCACGCTCAACTTTaaggagaagatggacatTGCGCGCGGC
CTCAGCGCTCTGGGCGTGGACGTGTGCGAGGCGGGTTTCCCCATCTCGTCGCCTGGTGACTTCGAGGCCGTGTCGGCCATCGCCAAGGAGATCGGCCCCA
TTACGGCGAACCGCGCAACTGGTGAACCCATGACCATCTGCGGTCTCGCGCGcgccatggagaaggacattCAGCGCTGCTACGACGCTGTGAAGCACGC
GCCCAAGCACCGTATCCATACGTTCCTGGCCACGTCCGACATCCACCTCCAGTACAAGCTTAAGATCTCGCGCGACGAGTGCATCCGTCGCGCTGTGGAC
GCCGTCAAGTTCGCCAAGAGCCTCACCCCGGACGTGGAATTCTCCACGGAGGATGCTGGACGCAGTGACCCCGACTTCTTGACGGAAGTCCTCGCTGAGG
TCATTAAGGCCGGCGCTACGACGCTCAACATCCCTGACACGGTGGGCTACACGGTCCCTGGCGAATACGGATCGCTCTTCCGCTACCTGATTGACAACAC
GGAGGGCAGCGACAAGGCTGTCTTCTCCACGCACTGCCACAACGACCTGGGTCTGGCCACGGCCAACACGCTGTCAGCTGTGCAGGGCGGTGCACGTCAG
GTTGAGGTGACGATCAACGGCATTGGTGAGCGTGCCGGTAACACGGCTCTTGAGGAGCTGGTGATGGCTCTGAAGACCCGCCCGCAGCATTTCCCCGTTT
ACACGAGTGTGGAGTCGACGCACATcacacgctgcagccgcaTGGTGAGCCACTACACTGGCATGTCCGTCCAGCCCAACAAGGCCATTGTGGGCTCCAA
CGCTTTCGCTCACGAGTCCGGCATCCACCAGGACGGTGTGTTGAAGCACCAGGCTACGTACGAGATCATGCTGCCGGAGTCGGTTGGTTTGAGCGAGAAC
AAGATGGTGCTCGGCAAGCACTCGGGCCGCCACGCGTACAGCaagcgtctccagcagcttggctACACGGACCTCACCCCGGAGGAGCTCGACTACTACG
TGGAGAAGTTCAAAGTGCTGGctgacgagaagaagacggtcACGGACGCTGACATGGAGGCGATTGTGTCGGACGAGCTGTTCAAGCCCGAGGCTTTCTG
GACTCTGCAGTCCGTGCACGTCACCGCTGGTAACCTCGTGAAGCCTACGGCTACGGTCACGCTTGCGCACAAGGACGGCCAGGAGGTGAGCGAGGCTGCT
ATGGGCACTGGTCCGATTGATGCCATCTACGTTGCCATCAAGCGCGCTACGGGCATGGAGAGCATCAAGCTGAACGATTTCTCCGTGGAGAGTGTGACGG
ACGGCACGTACGCTCTGGGTGAGGTGACTGTGCGGGTACAGGAAGacaaggaagaggagaagaaaacGGAAGACGAGAAGCACGTGAACGCGCAGACGGG
TGTGACGCGTGACCGCCAGTTCGTTGGCCACGGTGCTAACACGGATATTCTGGTGGCGTCGGCTACGGCCTACGTGAACGCCGTAAACCGCATGATGGCT
TCACAgtcgcgtgctgctgccgaggcTCGGGTGGGCGCCTAAGATTACGAGAATACAACATCAAAGTAACAAGGTCCTCGTCGTGAGCAACCGCAGATCT
CAGCAAGGAATTGTCTTCGCAGTATGATACCAAGCCAACGGATACCCGGTTGCGAAGGCGAGTGCCGTGCGTGTGTACTATCTAATCGGCTTCACTACGC
CAGCAGAATGAACAGCAAAAATATAGCGTCCAGGGTCGCGATCGAtgcgagctggagcaagtgTCTCTACATGCCAACTTGTTGCTTTCTTCTATCTGTT
CTACTACTCAGCTGTCAGCTGTGAGCCCATCGTAGGGTGTTAGGCCGATGTTGTTTTCAATGGTGTCGTCGGCACCGTGTGCAATCAGGTACTCGCCAAT
GACGCCTTCTCCGTCGTAGGCCATTGCGAAGTGGAGTGGGGTGTTGCCCTGCGCGTTGCGGTGATTCACATTGGCTCGACGAGTGACAAGGAGCTCGACC
ATCTTTTGGTTCACGTTCTGGCAAGCGAGCAGTAGCAGTGTGTTGCCcttgtcgtcctcgctgtcgaTGGGGAATCCAGCATCCAAACTTTCCACTAGCC
GCTTCATCCGACCATTTCGCGCCTGCGAGAACACGGTGTCCACTTCCAACGATACGTCTCCGGTCGGTTCTTGTCCccgtgctcgtgctgctttcACCTC
GTGGTTTACAGCATCAAGTTGGGTGCGTTCGGCCGCCGTCAATGGTAGCAACTTGTTGCGAGCGGTGATCAACTTCCGAACGTGGAGTTTGTGTGATACG
CCTAGAACTTCGGCCATGTCTTCTGGACGAAGCTCAATGAGGAACTCACCATCCACCGCGCCTTCACGGAACGCAGCCTTGTACTGCGGAAGCGACAAAC
TGTCGAGCCATCGACCTACATCGTCCACAGTCCACGCGCGCAATTCCTCAGGCAACGGCTGCTGTTTTCCTAAaacttccgcttcttctcgttgctgctg
tacgagttcttgctgcttgcgttgAGCCACAGAAGCTAACAAGTCGGTGACAGCATCCTTACCAACCTTCTTCTTTGCGAGAGCTGCGGTGACCGGCGTT
AaattggcagcagcagcggccgctgcagcggtggcggcggtctCTGCTGTACTTGTGATAGCTGAGGCAGTGGTGTCGGCGTTGATATCGCGCAGGTTCT
TGAGCATGTTGAGTGAACTGAAGTACGACAAGGACATCGACATGAATTGGAACTTCATGAGCTCCTCGGTGGACTCGAACATGGCATGTGACCGTGCCTC
GTGCTCTCGTGctttcgctgctgttgctgccgccgccgctgccgaaGTGGCTGTTGCAGTCTCGAGCTCAATTCCCTTTTCACgcaagttctccagctcc
agcttctgctcttCCAACAATTCCATGAGATGTCGTTGCAGGCGTGCAAACTCTCGGTCCTTCCGCATGCGAGTCTGCTCCATGTCCGCGAGTCCCTCTT
CCAGCGCCGCTAAAGCCTCTCGCTTCCGTTGCACCTCAGCGAACGCGCCTGCAAATTCAGCTTCAAGATCACGCTTTTTCTTCTCACGCTCACTGCGCTT
GATACTGAGCGCCATTTCAATAGCATAAGCATCGGCTTGGCGCTTCTTGAGATTTTCTTTCGACTCCAGCGCATTTTCCGCACCGAGTTCGTATGTTGCC
GTGTCGTTGATGTCTGGTGAGGGCGAAGAAGCTTCAGGTACTCCACTGCCAAGCGGCTGATGCTGAGACGATGAACGGTGGTTGCGTAGTAAACCTTCGA
CCCCACCAGCATGAAGTCGTTCAGCTTCGTGTGTCAGTTCGCGTACGTCGGCATCCAGCTGGTCGAtttcctgcagctcgcgttCCAGCACAGCCAATTC
TTTCTCGGCTTCACGCAGTTCGTTGTGGACGGCACTAACTTGACGctcggctgcttcttgtgcacGATGCAATGCATCTAACTCACTCTGCTGTCGTTCA
AATGCCTGCTTTGAGCCTTCAATCAATTGCAGTCCAAGGGACAGTCGTTCAGCTCCAGGCGGTGCATCTCGccactgcttcttgcgtgcagcttgtcgtc
gtcccATGAGACCACGATACATCCGCTGGATCTCCAGTGCTGCCAGTTCCGAAAACCGAACAGTGAGAAATTCTCCACGGGCGACGTACATGCGCCAAGT
TGCTTGGATTTTGGCAGCGTTTCGATCCTGAAAgcgacgtcgctcttgctcCACACGTAGTCGTCGAACACGGTTGCGTCCAAGATGGCCACGAAATatg
cgctgcagcatgcgAGCCTTGCTGTCGCGTAGTTTTGCACGATAGGCCACGCGACGAGAAAACCCCCGGAGGACTGCCTGGATGCGCGTGGCAGCATGCG
ATTGCCTTGCAGCCTCCTCCCTCTCGTCGACAAATCTACGGAATCGTTTACGACCAAGCCGGCCACGTGCAATTCGCACGATctcaccaccagcaaagtT
TTTGACACGGTCTTGCTGCGCCTCTCGACGTATACGCTCCACTCGACGTGTTGCCAAGAACCGACGGATGTACTTCTGCACTCGTGTAGCTTGAGCATCT
CGCCTTCGTCTCAATTCACGCTTCATGTTGGACTCGTTTGCTCGAGTGTCTTCTCGAAAGTTTTCCTTTAGCGACGTTCGCACCTCGTCGTACTGCTCGC
CGGTCAGATGACTTGCTGTCACTTGGCCAGGCCCCAAGGCACGTCGTTTCTGCTCTCGCCGTCTACGAGCTTGTTCTTCCACCTCGAGCTGGTCGAACAT
TCTTGGGAGCTCTGGTTGCTGGCGAATTCGCTGGCGTGTTTCGTCCACAGACGGAGACAACAACGCGCTAGGTGATTGTATCAAGGGCGTAGGCAATTCA
ACGGACGGTTCCAATTCCAGCAAAGGTGTAGACGATGGTGTTCCCGGTACTGCGTTATCTGCAGCGAATACTGCCTCGTCCTTCATGAGTTGCTCCAGGT
CTCGCTGTTGGGATGCAGCGAATCTCTCAGCCTGTTGGGCTTGCAATTGTGCCTCAAGAGCTGCTAGTCGATCACGATCCTCTTGCTCCCATCCCCGCCG
TCTCCGGTCTTGCTCCTCTCGCAAAGCAGCCATTCGTACCTCAGTTGCAGCACGATGCTTCTGACGCTGTTCTTCCGCTTCCTTTTCAAGACGTTCCTCT
TCGGCTCGAATCTTGGCTCTCACGCTCTCAATTCCGTCGTCCAGTTTAGAGGCTTCACTCTCGTCATTTTGCTGAAATTGGCGCGGGTTGTTTGGTATAT
GCTGTGGGTGCAGTACAGCTGGAGGAACGCTAGGTGGCAGTATCATGTCCATGGGCACAACCGATTGAGTCACAGGGATATCTGCAGCCTTCAACGTCGG
AGTTGATGCTGGGGGTGTAGCCTCAGCCGCAGATTCTCCAGCAAGCTGttctttttgttgctgttgaagccatttcttcttctcataAGCGGTCTTCTGG
GCCTCGTGTGTGCGTAGAGCCTCCTGGAAAGTGCGTTCGGACttttcaagttgaagctcaTAAGGAGACTTACTGGTTTGCTGGGACGACACGCTTGCTG
TTGATGAATTGGCCACTAATTCTGCAGCTAATGGCAGTGTTGGTGTCTCTGAagttggtgcagcagcttggtatTCATTAGCACTCGTCGGTGAATCGAC
GGGTTGGTTTACGATGGCGTGTCGAACTGCCGACTCCTTTCTCACTGAAATTTTCTGCTGATCCTGTGTCTGTGGTGATGCTGTATGGTTTCCATCGGTT
TGTTCCACAGCTACGAGTTCTTCATCTAACAGCTCCGCTTGACTGTTCACAAGCATTTCGATCACCTCGGCAACGTAGCTTTTcgcttcttgacgaagct
CATGCCCAGCACGAATCCATGATACAAAGGCGCTATCGGGCGTTGCTAAAGCTTTCCTCAATTGGGCCCGGGTCTTGGAGCGCAGGTCACTAGTATGTGA
TTGCTGATGAGACCACACATGCTGTACATTGGCGCGACCTTGAAGGAACGAATCGACGTTTGTGGGAGATACCAGCGTGTTCTCCACAGACTGGACAAGA
ATGATCGGTGCACCGATCTCTGCAAGTTGAGAGCCAAGATCCACGTGACGAAGTGCACCACGGCATAAACGAATACGACCATCCAGCGTGATAGCGTTGG
TCACGGCTGTGTAAATGCTGAGAGCTAAGTTCATGTCGACCTTGCGCAGATACGCCTCGGAAAAGAGGAACTTGCAGAAGAACGACACGGGTAAATCTGG
CCGTGTAGGAGGCAAGCAGGCAAACACGTTCACTGCACTATGGAGCACCGCGGCGAGTTGTGCATCTACACTCGCAAAACCATTGAAaagcgccagcgac
tgcaaatACCCGTCGTAGTTTTTGCCGTACAACACCGAATAACAAGCTGCCACGTTAGCTCCGTTACCGAAGCCAACGATGTGGAATGGAGCGCCTGTTG
TCACGAATTGAGTAGTGTGTTGCAAATAGTTGAGCAACTCGTGCACTCGACGAGCAAGCCACATGTTGTTCAGCACAAGTTTGTCTTCTTCACGGGCTTG
ATCATCAACAGCGTACGCAGAGCCAGCCTGGCCTGGAAAGTTGAACAGCAGAGCTCGGGCACCCACATTTCGGCCAACAATGGGCTGAAAGAACACTCGA
GTACTTTCAAACGTATCGAACAGGTCATGAAATACTACGAGGTTGCACTTGACGGTCTCACCGACGGGTTGGCCGATAACAGCGTATGGTATCTGCGTGA
CTCCATCCTGACAGGTGAATACGTTGTCTGCAGTGCTTCCTACTATACCATCTTGGAGGCCTGACGGTGCAGCAAGACGTGTCATTTGCTGCGCTTGAAT
AGCGCGTCGAACCGCTTGCTTTTGTCGTGCTTTTGGTAGGGGACTTTCATTACTCGCGTTGAGTGCCTTAGTTGTTGAGTTCTCACGTCGGGGTTCTTCT
AGTTGAGAAGCAGTGACTCCGGGTGGTAGAATCTCGGGCTTGAGGAAGCAAAGCATGCGTCGTGTCTCCGGATCTTGCATTTGTAGCCTCTGCTTCCACG
CGTAAGCCTGCAGCACAGTCCGGATCCAGTCGCAGAAACGTGCTGCACATGAACTAATTGGCGCGATCTGTCCCGGTGTGAAGAGTGGATTTCGagcatg
agctgctgcttgcatcACCGCACGCTCCGAAAGAGCCTCCAGATCTACACGGTGCAACCGCGCGACAAGCTTGTCCTGTGAGATCAGCCGCTTGACTTCA
CCCCAGTCCCCACCTCGTGACCCCAACAGTAAAGCTCCAAGTCCACTCAAAACCATTGCTACAGCAGGATGTGGATTCACGAAGCTGTAcagctctgcag
catcttTCTTGGTGATAGCTGCAGCCACATTGGAGGTTTGTGCCCAGACGTGTTTCCACACGTGTTGCAAGTTATCGTcattgttgtcgtcgtctgcagc
atcttcttcctctcctctTTCTGCAATTGAAAATTGCTGAGCGTGTTTGCCTGGACTCCGGCGGTTTGGGGTCGTTTTCTGACGTCGTGCGATTTGATCA
AGAGCTTGCATGCGGACCTTTTCAACGAGCATGTAGAACTCGTAGCAGTTGACGCACACCTGCACGTCTCGGTAATAGTATCCGGGAAACGTGAACCCGA
GAGGTTCACCGTCTCCGTAATAGGCTTCTGCAAGGTAATCACCTTCATCGCCATTCTGGTACCGTCTAATGAACAGATCCACGAGTTGTTTTTCGGCTCG
AGTCTGTGCTACGAGCTTGAAAGGGATGGTATATGTCGGAAGTTGAGGTTGTTGTGTCTCGGCACGTTGCGATCGCTGTGGAGATGATGGTTTTCGCCGC
TCGGCTAATCGACCCAGCAAGTCATCCGTTCGGCGAGCATCCATGAAGGCGCttgcagtagctgcagcattggcagcgcTTGTCCGTCGTCGGCCCTTTC
TCGCATGACCAGCCAGCTCACTTAGCGTGGCCCCCTTCTTACGCTCAATTCGCTGGGCAGTCAACTCGGCAATGGACAAGCTACAAAagtctccgcagca
gccgcgctTTTGACTTGACATAAGGTGAGCTGCTGACAGAGTTCGCTTTCGTCCCcgagacaacgacgacgtaGTTGGAAGGAACGACAAGGCTTCGTCC
CAATCGCTCGAGTTCCGCAGATCGAGATTCGCACGTCGTCTACCTCCCAAGTCCTCTAGCGGGTCCAACCGCGTCAAAGATGAAGGTGAAAGCAGTCGAG
TCGTATGTCTGTTGGAATAcggtgatggagctgctagGATCGCTTCGACCAACCGTTCGTCGGGTGCCCGTGATCCTTCGATTCGGGCGCGAACAATTAG
TCTCTCGTTCATGGCGCGAGGTCCCTCGTACGAGCTTGAAAATGATGATACTAGCGCGTCCGGAAATGTCGGCGCTGAAGGCAACGCTACCGCTGCAGAG
ATGGTCTCGCACGCGAATGTTCGCCACAAATGAAGTTTCCCGCTGTCTTCCATGATAAAGAGCGATACACAGCGAACCACACGACACTTCTTGTTCTTTT
CTAGAACGCCCACGAAATGCTGCACCAGTTCGTTGGCGGCGGTATTCAGCTTCACGTCCTTGCTAGCAATCCGCTGCCCACCCAGTGCCAACCAGAAAAC
TTTTCCCTGTACACGGCCGCTCTTCTGAAGGCTATGCAGACACAATACGCTATTAATGCACGCTTCAAACATCGAGTAGGACCATCGCAACTGCGAGGAA
CGTACGTGAACTCGTGCTCGAGGTTGGCATAACAAACGGGGTCCAGTTCACCCCGTGGTCGGACGAAAGTGCTGAGGACGGCGCTgcaagcgctgctgga
caaaaGTGACTGCAAAAATGCCAACAAATCTGCCGCAGTGAGGAACGGCACGGCACCAGGCGTGTCATTCTTCTCAAACCAGCAAACTGCGATCGGTCTT
GTCGCCGGGTCCaccgcagcgtcagcaccgcCAACTTCAGCTGCAAACTGAACGAAAGCTCTGTGAACTTGGTCCGGCGTGAGTCTGCTCTGCGGTTTGC
GTCGTACGACACCAGCGTCTGTAAAATACCACGACcagatctgctgcttgtccacgaacacg