Description :
From Genome Similarity Track
Location :
Scaffold_110:115991- 119736
Sequence
3745 bases(100 bases per row)
GAAGAGTGCACCCGCTCTACCGACGGGTACAGAAGGTGAGGAAGGAATACATCTACACGGAATCGAAGTACCCCCTCCGTTAGTCGGTCGTCCGGGCGCC
AGTGAAGGGTCGGGATTGTCTCATAAAATGAGCGATCTCCACTCCACCACAATGGTGCGCGTGCCCGGATCTTCTGGTGACTCGGGATTTACCGTGAGTC
CTGGTGTGAAGAGGTGATAATCAAGATGGAATTTGAGATGGAAGCGTCAGAGGTTGAGGGTTCGCCACAGACGCGTGATTTTAAGGGTTCTTCAGATAAT
CGGAGTTTTGGGAGGGGCTCTGATAACAAGAAAATCAATGAGGAAGATCGATCGATCGATCTGGAAGAGAAACACCAACCCCCTTCTGAGGTCCCTTCGG
GGACCACCGTAAATCGTGCCGCTAAGCAAGATCGGCAGGGTGAAAACCCTTCAGGTAAAACCGAACACTTACCACCCAAACCTCTCAAGCAAATTCAAAG
GCGAAGAACGTGAAGCCAGCACGAGTGAAGAAATAAGCGTCCAGATCGGGTCAACACAATCGAAGCTCAAAACCGATGAATTGGCCGATGAAGTTCGTGG
ACGATAATATGAAGATGGAAGGCTGGCAGTTGGATCAGTTGGCGCAAGGATACCACTGGACGACACTCATAATATTCTAGCAAGTAACCCAGTGCTCCGG
ATTCTGAAGCCCAAGCTGATCGGAGGAATCTAAGGTCCGATACCCCCACCGGCAATAGCGTCTAATACGCTGGATGAGATCAACGGGATCATACGGCTGC
TACATAACGCTGGTTTTGTAGGAGGAGTGTTCGACGCGAACAAATTTTTGGAGTGCGAACAAGATCAGGTGACCCATGTGTGTCAATTGCTATACGACAA
GTTAATTCCCCTGACGGGTAAGTTTGATCCTACGGATCAAGCGGACACAGCGATCGTAGACGCCCCGAGACGATATCTCACCGGATCGTAGCAGTACGCG
TCAGCTGAATATGAAATCGAGTCGGATGATTTGATCAGAATTCAGCGGATGTCGATATATCCAAGTGGGAGGCACACCTGCTCGATCGCGTTAAAACGAT
TAAGGTCAAACCAAGATCGAAAACCGCCCGTGCTAAAGGAGAGACGAATTCGACTACGCAAGGACACCTGCAGGCGTACTTTAAAAAAGGCCCTCGAACA
TATTCAACAAGAACAACGGGAGCGAGCGTATCAAGAGATCTGCCCTAGCCAAAGGATTAAGACTCCAAGAGCTCAAGAAGCATACACCCCGGATGTCGAG
ATGGAATCTATCCGATCACACCTCAGTCGATCGGACATTCTCGATCCTGAATATGTCGATCCCGATAATTCAGGGCAAGAAGAGCGGAGACTTGCGGTGG
TATCCACCGCAGAACCGTTGAAGAATGGTGGTGAAATTCCCCAACGTATTCGTGTGTTAGCGATGACGGTGCTGAAAGAATTCAGTGGTAAAAACTGAGA
TGAAGATCGGTTCAGAAGCTGGATCAGCAAGGTCAAGTCGGAGTTCATGCACGATCAAGTGCCAGACGAAGGAAAGTGTTTGGTGTTCGGCGATCTGTTG
ATAGGGCCAGCACGAAAACTGTACAACCAACTGAGTCGATCTACACGGCATAAAGTGGAAGCGATTGCTGGATTGTTTAATGATACAGTATGGAGGGCAA
GGGGTGTCTGTGGCTAGAAAATATTATCTTGCACGGAAGCGATCAGATGAAACACCGCTGGAGTACTTGCAACGTCTTAATGTCGCGGGTAAGCACGCCA
AGATCGCGATCAAAGAAGAAAGATTGGCCACATCTGCCACACGTCGCGAGCACGTGGAACAATTTATTGCTACGCTTGACGATAGTGATCTGGCAAAACA
ACTGACCCTACTGCGATTGATACACATTGCCAAGATGGAAGAAACTCTACACGCGTGCCAACGGATGGAGAATCGCCTGATGAAAGCGTCGATGGGATCG
AACAAATTCCACCAGCGAACGACTGTATCTTCGAATCCGATGTCGTCAAATACAGCTCGGGCGGTGCGAGCAATCCGCGAGCAACTCGAGAGCAGCCGAT
CGAAATTGGATTTAAATAGATCTAAAGAGGAAGTGGATAGTCGTCGTGTTTGTAACAACTACATCCGACCAAGAGAAACCGGACAAGGATCACCGCACCT
GGCAGAAGAACCCTGGTGAAGGGGATGGAAACGATCGTGGTGGATGATCGTAGTCGTGTATCCACTGTGTATTTACCAAACACGATGATCGAGGATGCTG
GAAGAGACAGACGTGCCAGAAATGTGGTCGCAAAGGACATCCCTCTGACAAATGTTTCTTTTTGTGTGCAGCTTGCGGAGAGATACACGAGCGTGGCAAA
CTCCCCATGAAGAGTTATTTAATTTGATTCAAAAGTGGTACTTTCCCACGAAGCATAATAGAATGTTTCCGCCCAAGTTGGAGGAGATGTTAAACTAGAA
TTCTCTCCAGGTTGGAACTTGGCACGAGCCGAGCTTTCTAGGCTCTGCATTGATGCATTTGTTGAAGGACAACCGAAGGTTAAGCGATTAACGATCGGAT
CGATCCGATCGCTAATATATATAATTATTCTACATTGGTCCTGTCAATATCAAGTGTGAAAAGAGTAAAGATTACGCCGATCGCCTGTGAGGATAGGGCT
CGACCTCGAACTAGGGAAATCAAGTGGGTATTGGAAATACCACCCTCCCGGAAAATGATTCAAGCAAGCAAAAGTGGCGGGCAAGATCAACAATGAGAAT
ACCACCATGCTGTTCCACTCTGGCGCTGAAGTGTCGATCCTCGATACTACCTCTGCTCGTTAGGTAGGATGTGTGATCGACGAAAGTCAAACACAAGAGT
GCGTCGGAATTGGAGAAAATGCATATATGACGGTGGGGCGGACGAAAATCAAGATTACATGGGACAGATCGTTGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG