Description :
From Genome Similarity Track
Location :
contig_237:11596- 12879
Transcript NameFunction/comments
g12228.t1hypothetical protein PHYSODRAFT_478459

Sequence
1283 bases(100 bases per row)
ATTACACCATTGCACGGCGTTGTTCACAAAGTCAACACTCAAATTCAAAAAGTGCGCACTCAAAATCAAAAACCTGTCAGATGTATTACCCTTGAAAATG
ATACTACGTCTCAGATCTTATCAAAAGTTACGTCCCAACTTCCATGTCGTCAAAGTGCAGCGTGCACTGGTGATGAGGCAGTGAATGGCAAAAACTCGAT
TGGACAGCGCTGGGGTCACCACTTCGGCAAACAGGGGTCTGCAGCGAGCTTGAGATACCCGGCACGATGCTCCGTAATCGTTGTGCCGTCGGGGACGCGC
AGGATGCCAGGACGTTGTCGCGCGAGAAAGCGTTTCACAGCACTCTTGTAGACAGAAAATACATTCTCTATCGGGTTCAGCATAGGGGAGTATGGCCCTA
GCTTCAGCATCTCGGCATCTTGGAATTCCTCCTCGGCGAACACATCCTTAGCGTTGGTGTGACACGGGGCATTGTCGAGCACGAGCACGACTTCATCCAG
AGGGGTGGAGGTCTTGATGCGGCGCAGGAATCGCCTGATAAACTCGTTCGCGAGTCCAGCAGTGAACGAGCCGAACTGCGACTCTTGGAAGGCTAGGCCA
GTACTTGAGATAACAGCAATAATATTAATATGTGTTCCCTTACTGGAAACACCAGTCTGTACTGCGCGCTGCCCCAGCTTGCTCCAGACACGCCCACAAG
TTAATGTTCGTTTCATCCAAATAAAATACCTTCTTGTCGTTAGCGAGTGCTGCGTAGAACTTGATCACGTACTCGTAGCTTTTCTGTTTGTTGATTGAGC
TGTTGCGGTTCACAACGTCTCGGTGCAACTTCTTGAGAGTGAAGCTGCGGGCGTCTAGAGCTCGCCGCACGGTCTCCCGGTTGACAGCCACGTCGAACTT
CTGCTCAACAAGGTGTACCATCTGGACTAGCGTCAACTCTGGCGTCGTTTCGATCTCACTGAGCAGGTAATCGACGTGAACAACAAGTAGCTTTTTTGAT
GACCCGCCGCGTTGATGTTGGTCACCACTCCAGTCTCCAGTCTCCATGGCCCTCTTGATCCAGCCCCATGAAATACGCTCGTTGACGGTGTGGAGCTCCG
CCACGGTTTTCCAGTCACCAGCGTTCTTTGCCACTCGCAGGATAGCCACACGCACCTGACTTGGGTACGTCTTGTACTTGGTAGTTGGCATGGTGCCAAA
ACAGAAATGAGCCTGTTGGTTATGCGAGCGCATGCTTCGCACTAAGTTTCCCGCCACCGGGAAGTGCATTTGACACCAATCAA