Description :
From Genome Similarity Track
Location :
Scaffold_94:115959- 117648
Transcript NameFunction/comments
Physo_141112hypothetical protein

Sequence
1689 bases(100 bases per row)
ATTCGCGGCGCCACACATATTCGTTGCATAGAGGAAGCTCGCGATCGTCATGGTGCAGGTCCTGCTCGGCGCTCTCCGCGCCGCTGGGTGCCGCGCCTCC
GTCGCCAGGTCCCTGGCCACGCGCAGCGCGCTGCAGCACGCCTTCTCCACGCAGTCCAGCGGTGCGTCTTGTCGACACTACAGTACTCCATTTGGAAAGC
AAGCATGTCATTATTGACACTTTTTACTCTACTCTACTGTACTGCACGATGCACAATTACTTATAACAGTGTACACTTGGGGCAACGGCACGCTGGGCCA
GCTGGGCCACGGCCCCGTGGTCAAGTCGGGCATCCGCAACGCGTACGAGGAGCTCACGCCCAAGCTGCTGGAGGCGTTCGAGGGCAAGGCCATCACGCAC
GTCGAGTTCGGCGCCAGCCACAGCGCTGCCAGTACGTCAACTCTTATTATTTATTTATTTATTTATTTGATTTCTTATTTGTGGGTATAAGAAAAAATAG
TGACCAAATATTGTGCATTTGTGCAGTTGACGAGGATGGCAAGCTCTACGTGTGGGGCTCGAACGAGTACAGCAAGCTGGGACTCGGAGAGAGCAGCGAG
ATGGAGACGCTCCCGCGCGAGGTGGAGGCGCTCAAGGGCGTCAAGATCGTGGACGTGTCCTGCGGAGACTATTTCACGGCCGCCGTGGACGCAGATGGCA
AAATGTACTCGTGGGGCTGGGGCGGCTCCACCATGAAGGGCGCGGGTGGTCTGGGCCACGCCGGCGGCAAGGACGAGCCCACGCCGCGACTGCTGACGAC
GCTGGTGGACCAGGGTGTACCCATCTTGACGGTGGAGTGCGGCGAGTTCCACACGGTGGCGCTGTCCAAGGACGGCGAGATTTGGGCCTGGGGCAACGGC
GAGTACGGACGCCTGGGCAACGGCGAGTCCGACACGTGCGAGGTGCCTGAGCCTATTGAGTTCTTCTCCAAGGACAACGTCGTGTCCATTGCCGCTGGCC
GGGACTTCTCCTTCGCGCTCACGGACAACGGCGAGCTCTACAGTTGGGGAGGCAACAGCCGTACGTTGGTGCTGCTGTGCTTAAAGCGGTGGGTGGTGTG
AGTGCTAATGTTTTGCTGTTGCTGCAATCATTGTAGAGAACCAGTTGGGCATTGGCGGTGGTCTGGCCATGGACGTGTACAACATCGAGTCGATCCCCGT
CCTGGTGGAGGCGTTCAACGGTCTGTCGGTCAAGCAGATCGCGGCTGGCTACGACCACGCGGCCGCTGTGACGGACGACGGACGGCTGTACATGTGGGGC
TCCAAGATCTGGATCGAGCCGCACGAGATGACGGCTGTGAACGAGTACAAGATGGTGCAGGTCGCTTGCGGACGGCAATACACCGTGGCTCTCTCGGAGA
ACGGCGAGGTCTTCACGTTCGGCAAGGGCAGCTCCAACTGCCTGGGCCACGGCGACCGCAAGAACCAGCTGCAGCCTGTGCAGATCGAGGCCCTGGCCGA
CGTGAACATCACCTCGTACGTCGCTGCTGGCTGGCTGTCATAGTTGATGAGCGCACTCATGGATTTTATATTAACTTTAGTTGTCTTTGTGGTGCAGGAT
TTCGTGCGGCGACTACCACATGGGCGCCATCGCGACACCCCACGCCGAGGCCGCGGACAAAGACTTTTCCTTCCGGGAGTAGGAGGCAA