Description :
From Genome Similarity Track
Location :
contig_53:115959- 117360
Transcript NameFunction/comments
g8769.t1hypothetical protein

Sequence
1401 bases(100 bases per row)
CACGCGAGGAGGGCGGGAACGCGCGGGTGCCGCGCGATATTCACGAAAAAGGGAGTCAGCCCCGGCGACGCGTGTTCCGTGTTGTTCAGCGCAAACTCGG
CAGGTGGCAAGAAGGAGCTCCAACTCGTGAACGAGGTCGCGTAGCTTCGAAGGACATCTTCGAAGACTCGGTTGACCCGCTCCGTCTGTCCATCCTTCTC
CAGATGCGTCGCCGTTGACATGAGCAGCTTCGTTTCCAGAAGCTGGAAGAGGCTCGACCAGACCGCCGATGTGAACTGAGGATTGCGGTCAGAGGTGATC
GATTCGGATAAGCCGTGGTGTCGAAAGGCCGCATTAACGAAATGCACCACGGACTCAGCCGCGGTGATCATGTCGGACACCGGAATGAGTTGGGCCATCT
TGCTGAACCTATCAACGAACACAATACACCAATTCGACCATTCACATTAGGCGGAAGCCCGAAGATGAAGTCTATCAACACTGAGCGTCACGCCTCAGTT
GCAATCGGTAGGGCTCGCAGGGAAACCTGCGACGACTTTGACGGCTTCACGCGCTGGCAAATCTCGCAAATACGGACTCACTTGCGCACCCACTTGTACA
TGTGGGGCCAACAGAGTCGAGGGACATTGCTGCGAAAGATTTTCCGCGGCCCAAGTGACCACCGATAGGGCTGTCTTGGAACTCGTGGATGATCCGAGCG
CACAGGGCATCGTTGTTCGGGATGACGATGCGGGGAGCATCGAGCCGATCGGTGTTGAACGTCAGCGGATTGCCGTCGAGTTGATATCAGTTGACTTGAA
TGTACGTGTTGTTCGATAGCACGCCAAGTGTTTTATCACTGGGGGGGGATGCGCGAGGATGGCGGCATATACCGCGTCGTTGTTGTTCGCAACGACGATC
TGTTCGCGTAACGGCATTTCTGGAGTCACGTTCATCAGGTTGACACCTGATGCAAAGCACATCGCGCAGTGATCTTCGTCATCCTCGTCGTCGTCAATCA
CTTGACGACCCCGCATCGCACGTGGATCACAGTCTGGACGCCGAGACAGAGCGTCGGCGAGGATGTTGTTCTTGTCGGGCTAGTGCACGACGATGTTGCA
CTCAGCGAATAACGACAACCATCGTATCATGCGTTGGAACAAATGTGGGGACTTTATCGCTGCCCACAGTGATACGATGCGTGATTTGTGTACACCACGA
ACCTCTGTTCTCCGAGCAGGTACACTCTGAATTTGATCAGAGCGTAACGCATCGTAAGGAGTTTTTTATTTGGAATAGTTGCGTTCGGCCGGCTTCATCT
GTCGCGATTGATAGCTCACGACCTGCATTGTCAAACTGCATGAGCGCACACCCGATGGCGAAGACGCTAGTGTCGTAGACGACGTGGAACGGCTTTCTTG
G