Description :
From Genome Similarity Track
Location :
Scaffold_37:11595- 18323
Transcript NameFunction/comments
Phyke_g2190conserved hypothetical protein
Phyke_g2191conserved hypothetical protein
Phyke_g2192hypothetical protein PHYSODRAFT_475569

Sequence
6728 bases(100 bases per row)
GTCACTCTAGACGTAGTCAAGAGCAGTCCAAGCACCAGTGAAGCTTCATCCATCCGCGACTACAGCTCTGCCCTGGAAGACGAGACCGACGAGGAAGGAG
CACAacaaaccacagcagcagagtgTGAAGTTTCTACTAACGAGGGTGTCGTAGAAGCGGAGATAGAGCAGGAAGAAACAGGCGCACAGGATCTCAAAAC
TGAAGAAGtagaggagaaggaggaagtCAACTCGCTTCAGCAGGTGGAGCCAGAGCTGGAAACGTTGAGTGACGAGACGTGGAAAGAAAGCCAAAaagag
gacaagaaggtggaaaAGTCGAAAGCTCGGCCTTCTACTGCTAGAAGtgccacttcaagttcaacctcGCGCCGTCCATTTGTTCCGTTGGCACCGAAAG
GTTGGAGAGTGAGAGCCATGCAATCGAATACGCAGATCACGCGATTGATGAAGGCGGCGTTGCTTCAGACGTTGCTGCACGCGATCCGCACTGGTTCTGT
GGAGGGCGTCAAGGTCGCTATCGAACGTGGCGTGCAGGTGCAGTATCTTGATAGCCGTCAGCGCAACCTCGTCATGTACGTGTGCAGTTAATTGGCATTG
ACTTGGTGGTTGTGCGTCGAAGCTCACATGAGTGTGATCTGATCGATTTTAATCTTTTAAAAATGTCCAGGTTGGCGACCAAGTGCGACACCGAGGCACG
TCTACAGATCGTGATTATCCTGTCAGACGCTGGGTGTGACATCAACCACACCGACCAGTttggctggagctgcttgcattATGCTTGGTATGTGCAATGC
TTGAAATTATATATGCTGTTGTATTTTACTCTGGTGAATACTGACTAGAGACTGATCGTTTGGTGCATGACGTTGCTTGATGCAGTGCTAGTGGAGCTGA
CGATGTGGCTATAGAGCTCATTCGCCGAGGCGCGCGAGTGGAATTCAATCCCTATGGCTACGGCCCTGAAGACTTTATTATTCCGAAGGTGGCACGCGCT
AAAAGCCTGCTTCAACACAcggagcagctgcagcacgaaCAAAATGTGTGTGCGACGTGGACATTCTTCCGTCGACAGTCTGAGAGAACCGGATATAAAA
TCAAGTGCAATTTGGTATGTATGTTATATTGTGCATGTTTCATTTGTTTGACATTAACCATTCGTATATATGTATGCAGAACTGTGACCTTGGCAAGCCA
CTGAAGATCACCTTTCAGGCCCCTGCTGGGCATAGCCCTCTCGACCGCATTCGCGTGGTCGACATGAACTCGGACGTGGCGTTGTGGCTACAGGTGTCAA
AGACATTCAGCATTCCTCCTGGAGACGTGGGTACAATCACCTTAGAtgtggagacgctggacCGACCTTCACTGTATCGCATTGTCTACGAGAAGTACGA
GCCAACTCCTATTCAACTACCGACCTCGGTAGCTGAGAGCAACTTGTGCGTCAAGAATCTCGACACGGGTACTACCGTGTCCATGGGCAGCGTGAATGAC
TTGGTATTGAAGGAACTCAAGAGCTCAAAGGCATCGAAAAAGTCGAAGAAATTGTCGAACTCTTCCAGGTGAGATCAGTATGACCACTAGTTTGGCTTCG
CTTGCAGCCATACTTATCTCTGTTTGATGTTTTTCTACAGACCAGCGCCAAAATCGGATAAGGCTACGAGTGTGGTGCGACGGGGGTCAACAACGTACGT
CTCTTCTAGCTGCTCAGATGTGTTAGATATAATATGGGTTGGACTTTGGATTGGTTTGCTTACCATCCTTGTGCTGTGATTACAGTCGATCCCGAGAGAT
CACAGAACGCAGTGACGccgtggaggaagaagaggaggagggaGAAGAGGCCGAATTTTCGGCTGAAGAAACTATTACAgccaccgaagttgctgaacAT
CCGGCGGTCACCAGCATAACCGGAGTGTACAAGATTGTGGCAATGGGAGTTGTAAGCGTTTCAACATTGAGAAGTGCCAAGGCCAATGAGTACGAGATTA
CAATTCGCCGCAAGGGCCCGCTTGGACTCCAAATGGTACGCATCTGTGTGAAAACTGCCTGAACCGTGGAGCATGCCACTGACTTTGTTGCTATGGTGGA
TTTGTCTCCAGGTACCTAAGCTAAATGGCCCCAAGAGCTCAGCACGCCTCATTGTGCGACGCAGTCAGGGTCAAGCCGCTGCTGTCAATCCGGGCGATTG
TCTTGTTGCTATTGGCAAAGCAAACATTGAGCACGCTGGTCTGAAGCACACGCTCTGGGCACTAAACGATGCTAAACGTCCACTTGTTCTACGCTTCCGG
CGTGGCAatgccaaggagaagaagagtcTGTTCAAGACTGGGCTCTCCAAGCTCCGAGGAACACGCTTGCAACCTGTCATCGCGGTGTAGTTGCAGGTGC
TGCGAGGTACActgcattttttttatttttgcTTCGGAGTATAAGCGTGATGCGTGAAAGTATAATCAATCGCATTGCGGAAACAAGGATAATGCGCATT
GTTTCTGTTGATGATCTGGCCTAAATCGAATAGCATACGATGGAGCGAAATGTACTGCACTACAACATTGGATGGCCCATGTCCACATGGCAATATTTGA
ACGATCTTCCCTTGCCAGTGCAACGCCGGCAAAGGCCCCCAGGGGTCGTTGTTACATCAATCACGTGCAGCGGATGCGCCTGGAAGGTACATGCACAGCG
CGTCATACATCGGCAGGCGATACGAGTACAACACACGATCAGTCATGCTGAAATACGAAAGGATGCGCCATAAAACCTTACCTTGAAGTGTTCTAGTAGA
TCATCAGGGTGGATCAGTGTTCGTGAGTCCGTCTCGGGATCGTAAACGATAGCAGGGTCTGCAATAGATATCGGATTCACCACGCGTTTGTGAGATACTA
AGTCACTTTCATAACTTTTCTTGCTAAACTCACATTgtttgccatcgccacgccaTATATACCAAGCCTGCGCTTCCCACCACGCTGGTTCTAATGATCC
TGCATTTTGGTACTGCTCATAACACGATTACAACAAACGACAGCGACAATGTTAGTAGTATGCACGCACGACAATTGGTACACCCATCCATCGACTTACT
GCGATTGCTAGCATAGACCCTGGCCGCAATGTGCTCGCCCATTCCTTCACATGCAGCAGATAGTCCTTGGGCGCTTTACCCTGCGTATACTTCTTCTGAA
GTAGCCATTCTCCTCCCTTGCCGTTCTGACGCCGTTTAACCCATGGATTATGTCCATGAAACGTCCAGGTGTTGGGCAATATGATTCTGTGCGGCTCGTT
AGGATCGACGTAGACAACGCCAAAGGACCAATGAGGGAACTGTTGGCGCATAGGTCCAGTCTTGTATCCTGTGTAGTAAACAAAGATCTTGTGCACACAC
GTCATTTGGTTGTGCATAAAGTGCGACCAGGACTCCTTGGCCTTTggcttctcctgcttgagcagcttctccaatgGGGCGTCAGCCAAAAACTCACTCG
TTGCACGCTCCGCCAGCACCTCCACATCCCTCTTGAACGCCTTATTGGTCTGCAAGCAGCCACTACAAGGTCAGCAAAGTAACCCAACCTTCTGCTATAG
CTGCAGAGCTCAGCTACGCACCATGCCCAGTCTACCGAGCGCTACAGGAGCCATGAACGACGCCAAGTACTGCTTCAACTCGAAGCTTAATTGCTGTAAG
TTCGTAACACGCTGATACTTGTGTAGTTTGTTCTGAGATGCTACAACCACAGCAGAACCAGTGCTGGTACTAGCACTAGCGTTAGCATTGGTACTCTCTA
CGCGtcgcttcttcgctgccttCCCTGTCAAGTTCTTTTGGAAGTACGCGCTCTCCACGCGCAGCATGCACGAGCACACGTCACGGCCGTTGCATCGGCG
TGTGTGACGCACAAGTTTCGCGTCTGGAAGAGGTCGCAAAACCTCCCGCTTGGctttgctgtcgttggtTGCTAGTTCCGAGCTCATCGCTTCcttgctg
gtgcttggcgTCTAGTCACTcgctgcacaaacagcaagcaaaaTTTATCCAATTCGTCGTAGTTTTAGTTAATTCATAGCATTTTAGCTGCAAGTTACGT
CTGGGTTACGCCACTGTAACCTTGTCAATCTCTGCGGCGGAGCATGCTTGCGCTACGACTGAAGCgcgctgaagctgcacggACCAGCAAGTCACGTCGC
TGGCTCGCTACAGCCTCCAAGGTGAAGGCAATCAACCGTGTAAGAGGCACACGAGATTTGCTAGCAGATGATGCCGAGCAGCACCGACAAGTGCTCGATG
TATTGCAGCGCACTGTCAACCGATACGGCTTTCGTCAGGTACGAACGTATCGGATGATTGTATTAACTTATGGACACTCATTGCTATACTATGCATTCTC
CTGGATGTGGATCGATTGGTCCATTATAGATCCAGACGCCGCTGCTTGAATACACGGATTTGTTCTCGCGGTCACTTGGTGATGGCTCTGATATCgtcat
gaaggtgctgctgagtTGCTGCTTGGAACATGAAAAAATGATTACAATCTAAAGAAAATAATTGCTATCTTGTGTTCGTGATGAATTAATTGCTATGTTG
TGCTCGTTATAATGCAGGAAATGTACACGTTCGAGGACAACTCGGGCAAGAGTGTAACGCTGCGACCCGAAGGAACTGCCGGTATGTTAATTGCTCATTA
GCAAGTGTCTGCTGGTTATGAACCTCACATCATTTTATATTGTACGTTGGGGATGGGTGGTGAATTTTGCCATCATGCAGGCATTATGCGAGCTCTAGTG
AGCAACAATCTGCTGTTTTCGCTGCCGCAGAAGCTCGCCTACTCTGGTAGCATGTTTCGGTTCGTGATGTTATCATTTTGCTACCGTCGCATGTTGAGAA
TAGAGTGTTAATATCTAACTAATTGCGTTTTGGTAGTACAGATACGAACGTCCTCAGCGTGGGAGATACAGAgagttccagcagtttgGTATGCTGAGCA
TTCGCGTTATATCATACGTGGGCGTATCTAACTGGTTTTGCGTGTTGTTGTACTTAGGTGTGGAGTTTGTAGGCTCTTCTGGCCCATCCGTCGATGCAGA
GGTATCCTAGTTTGGCCCAGGAGTTTAATTCACAGTGACCTCATACTATCTCTATCGACTCAGATTATCGCAATGGCGGCCGACGCATTGGAGGCTCTGG
GCATCAAGGATAAAGTTACGCTGGAGTTGAATTCTCTTGGTGATAGTGAAAGGTTAGAAAGGGTCCATTGTTGCTCCATATTACCATTACCTCCTTCAGA
CCAGCCGCAAGCTAACTTTTTTCTGGTACACTCGTCGAAATAGTCGCACAAGGTACCGTGTAGCGCTGGAAGGGTACTTTTCGCAGTACAAGGACGAACT
CTCGACTGATAGCATCAACCGGTTCGTTGACCTAACTTGTCCATTTGATTGCGCCTTAGTATGCTGTGAATGACTCGTTCCGTGAGACTTAACAGCGATT
TGGTTCACGCGTTTGTGGCAGTCTCGAAAGAGGAAGTGTTCTGCGGATCTTGGACTCAAAGAGCGAGGGAGATCAAAAGTTTATAGTCGATGCTCCGCGT
CTGGGCGAATTTCTCTCTGACGACGCCAGAACGGTAAAACATACTCCATACGAACTGTTGGGTTGCCATTTATGGTGTGCTCATGTCAAGTACATTGTGA
TATACATGATAGCGCTTCGAAAATGTTTTGACCGGCCTGGACGCGCTTGATATCAATTATAATCAAAATTCACGCCTTGTGCGAGGATTGGTAAGTTCTC
CGGCTATGCATCTTTTCCAGGTTTGAGGGTTGCTCATGCATTTTTTGTGGGAACTCTTACAGGATTACTATAGCCACACTGTCTTTGAGTTTGTGGAGAG
GCCAATGTCGGACGACCTAGATAAAGAAGCAACGGGAGGGGGTATCGCGGTACTGGCGGGTGGCTGTTATGATGGGCTAGCAGAGTCGCTTGGAGGTCCT
CCGACTGCTTGCGTGGGATGGGCGGCTGGAGTTGACAGGCTTAACCTTCTTCGTGAAATGCCAACTGAGGTGACGTTCACTGTTGCGGTACGATGAACTG
CGCTTTCTTTAAGAGTGtatctctctctcttttATCTAGGTTTCATGATTTTTAATGTTGTATGCTTCTCTTTTTCTGTTGATACCTACACAGGTCGTTC
CTGTTTTTGCCGGAGATCAGGCAGACCGCGTATTACAAGAATCAATGCGAGTCGCTCAGGTATGGATCACAGCACAACCCATATCTGCTATACTATAGCC
CTGTCGACACCTTTGTTCTTGCCATAAGATACTGCGTTACTGTGTGCTCAAGTAACCCGGTTGTTACGTGCAAAAATATGTTTTACAGACGCTCCGTCAG
CGTGGCTTGACAGTTCATTTCTGCCACGGTCGCGGAAATATGAAAAAGCAAATGAAGGTAACGATACGAAATGATACGCCTTCGTAGTTAGCTGTGGACA
AAATGTTAACTTGCTTCTGTTCTTGCTTATGGTGCAGGCAGCTGAGCGGTACGGAAGCACGCATGCTGTAATTTTGGGCGTCACAGAAATTGAACAGCAA
AGTGTGAAGGTAAAAAACCTTCAAAGGCGTGAGGAGTCCGAGGTGCCTATGACAGAGCTAGGCAGCTTCGAGTTTCTTTGAGGTGCTTAAACCGTGTTGG
AGAGTGGAtctctgcttctgctccggCT