Description :
From Genome Similarity Track
Location :
Scaffold_57:11594- 17121
Transcript NameFunction/comments
Physo_137736reverse transcriptase

Sequence
5527 bases(100 bases per row)
TCGGCTGTGTCCGAACTGAAGGACTTCAGCGGCAAGGAACATGACGAAGAAGCCGTCCGAGCCTGGTTCAACAAGGTTAGAACGGCTTTCCGACGGGATC
AGATGCAGCCAGACGAGATGTGCTTGACATTTGCCGATTTGATGATAGACCCTGCGCGCAATTGGTATTACCAGCTGAGCCGCACCGCTCGCGCGTCGTG
GACTGACCTGGGTGAACAGTTCCAGATCCACTTTTGCGGTAAAGGGATCTCCCTCGCGCGCAAGTACTACCACATGCGGCGCGGGAGTCAGGAAGACCCA
CTGGATTACTTATACCGGCTGAATCTGGCCGGGATACGTGCAAACTTGAAGATCCATGATGGCACCAAGGAACAACGACGTGAACACGTCGACCACTACA
TCGATACAGTCCAAGATGACGATCTCGCCAGATCTCTGGTAGTGTTGAGGCTGCCTGACTCAGAAGCTCTCGAAGGCGTCCTGTTGGTCATGCGACGCCG
CCATCAACGTCGCAAGATTGAGACCCAAGGTTCGAAATACCGTCAAAAGGCTCCCGCCCCTGCAGCCTCCTCGAGGGCGGTGCGGGTTGTGACTACCGGT
CGCGGACGCCGCGGAGATCACGAAGGTCTCAACGAGTTCGAGGGCGAATCAAGCAGTTCCGATAGCGAATCTGAAGACGAAAGAGCGCACGTGTTTTTGG
CAGCTAGGACGCCTACACAGGGAGATGGCGAACAGCCAGGGGGGCGCCAAGACCGCGAAGACCAACTGGGGCGCCCGAAGCACGGGACTCGATGCTCACA
CTGCGGATCTCGCAAGCATACGGATCTCGGGTGCCGGAAGAGGCTCACGTGCCAGAAGTGTGGACGCATGGGCCATCCTACCGACAAGTGCTTCTACGTC
TGCAAGTGCTGTGGAGACGTTCACGAAGCAGGTCAGTGTAAAATCGGCGACTTCTTCGATGCTGTTCGCCAATGGTACAACCCGACTCGCCATGCCGGAC
TGCTGCCCGAGAGCGTCGAGAAGGCGTTAAACTAGACCGCTCGCCAGGCCTGAACAGCCTGGTACGTGACGAGCGATCGAAGTTCTGCATTTATACATAT
GTTCAGAGGAAGGCGCGAGCGTTAGAAGACCCAACTTCCTGTAATGCGGTAAATACAGCCAGAACTCTTACCTCGGATGAAGATGACTATTCGCGTCGCC
CTTGTGCGATGGCCCTTCGACTGTCGCCGCGTGAACGTCGAGGTTACTGGAAGTATTACACTCCCTCCAAGTGGTTCAAGCAGTCGAAGGCGACCGGTGC
GGTCAACAATGTCCGTGCCGTCCTACTCTTTGATACTGGAGCCGAAGTGTCGATAATCGACTCTACCTTTGCACGTAAGGTGGGTTGTAAAATTGATACA
ACCCAGACAGTGGATTGTGTTGGTGTGGGGGATGCTGTGTACCGCACAGAAGGCCGAGCAGAAGTCAAGCTCACTCTGGCTGGAGAGTTGGTGTACAAGT
TCCGTGTGTGGGTTGGAGATCTCTCAGGACAAGACGTCATTCTCGGCATGGATTTTATGGTTCCTGCGGGGGTGAGGTTGGACCTGGCTGACGGAACGCT
CTGTCTGCCGGACGAAGTTCGCATCCAGATGACCGACCGTAAGCCACTGTATAGCAGCGAGGCTGACGCGGTCTACGCAACGGGATTCCATGAAGTCGGT
CCTGGCCAATGGACAGAGATCTCACTCAAGTCCCACAACAAGCGGTTTGAACTGTGGGTAACGAGAGGAGAAAAATGGGTGATCACGGTGGTGAATGGTG
GGTTCAGTAACAAGTCATACCTCCGGATCACCAGCATCAGCACGGGCCGCCTGGTGCTGGATCGTTTGGTGTGTTTGGCAATCTGGTTACCCGTTGGGCA
GATCCCGCGTCGACCTGGATTTGGTAGGAAGGATTCAAACCGCTATCGGGAGTGGCAAACACTTGCGTTCGAAGCAGCTGTGGATACTGGAGATGCAAAC
GAAGCGGAAGTTGAAGAGTCTGGACCGCCGGTCGAGCGTCCTAGCTACCGGACTCCGACTGCGATTTTAGCACGGCCTCCACAAGTGAAGACCGTTGAAG
CAGCAGCAACGTCAGAAGAATGCACGCGACTCACACTGGACGACACACATCCTCAAATGCAGCTGATGAAAAGTTCGACTGATCCGACTAGGGTGACCGA
AACCGAGGAGGACGTGATCTCTACCGATCCCGGTCAGGTGATCTCTGGTATGGACAGCGGTGACTCCAGTCTACCGCGTACGGAAACTCACGCAGGCGAG
GAGAGCGGCCTATCCTTTACGAACAGTGGCGAAACACCTGTAGGCTTGGCGTCGACTCCGGCAAATGTGGCTGAGGCCGAGCTCCGCAAGGAGTTCCCAG
AATATACCCCTGACCTCATGCCACAATCCAAAATACACGCCGCGGCCACCGAGGAAATGGTTCATCGCACGTTGTCGGTCATCGTTGAAAGCGACTGGAG
CGACAGCTGTAGCTGTGCGTCCGAAAGCGCTGAGTCTACTGGTAGCTGGGGTAGTTTTGACTGGCAGACCGACGACGAGAAAGAAGAGGAGCCGGTGAGC
GGAATGCTCCCAGTGACCCAGGTCGAACCAAGCCAAGGCGGAGATGCAACCGACATGGATGAAGCGAAGTATGTTCATGAAGGGGCCGATCTCACTGCGG
AAGACATCGAAAAGGAGATGGCGGTGTCACCAGAGATCTCCCTGACGGCAGAAGTTAAAAGGGAAGATCTCAAGGTCGGGGATCCAACTGAGAACACAGC
AGAGGAGATTGATCGTATGCGTGATATCATTTGGGAGCGGCGTCACCTTCTCATCGGCAAAGGCAATGCTTTACCCCCTGCGGTGACGGGGGCGAACTGT
GACATCGACGTTGGTGGTGCACGACCGGTGGCTCAGCGTTGTCGCCGGATCCCGCCTCAGTTCCGTGAAAAGGTGTTCCAACTCGTCAAAAGGGCTACTG
GGGGCGAAGATTATTCGGATCTCCACTTCTCCTTGGGCGTCTCCGATCGTTATCGTCGTCAAGAAGAACGGCGTGGACGTCCGACTCTGTATCGACTACC
GTCTGGTCAATGCTCTGACACGACTGATGATCTACTCCATGCCGTTGATTGACGACCTCCTCGAAGATCTCGACTGTTTGCTGTGGTTCTGTTCTCTCGA
CATGGCGAGTGGGTTCTGGGTGGTGAGTATGACCGATCGAGCCCGAGAGATGTCCGCGTTCATTACGCCGTTCGGCCTGTTTGAGTGGCTGCAAATGCCG
TTTCGTCTGAAGAATGCCCCCAAATCTATCAGCGGCTGATCGACAATGCGTTATATGGCGTGCTGCGGATCTCGCAGGGTCAAGATCGCGCGGATCTCGT
CAACATTTTCGAGGAAGGTGTTCCTGAAGATCGATCGCTGCCGTCGGTGCTGGGGCGTCGCTCTTACATCGACGACATCTTAGTTGGAGCAAGCTCGTGG
GACGAACTGTGTGAGAAGGTCAAGAAGCTCCTAGAGGTTTGTGACCGCTGGAATCTGTCTATTAGCGCGGAGAAGAGCAGTTGGGGTATGAGCAAAGTCG
ACTATCTGGGGCATAAGATCTACGGTGAAGGTCTGTTCACCAAGCCGAAAGATTTGGCAAGTCTTGAGGCGTTGAAGTTTCCCAAAACGCTTAAGGCTCT
CCAGTCATTCCTCGGCAGTCTCAACTACTACAATCGCTTCATCGAAGATTTCGCAGTATATGCCACAGTGTTGTATGAGTTCGGAGATTCCGATTTCATC
AAGGATCGAGCCACAAACGTCAGCGGAAATCACGAGGCGACTGTGAGATGGGACCACGCGCTACGAGCCTTCGATACCCTGAAGTTCAAGATGATCAACG
CACCCATGCTCTACCATTTTGCCCCAGAGTTGGATCCTGTTGTGATTGTGTACGCAAGCAAGTGGGCGATCTCTGCCTCTCTCGTTCAGTGTCGTGATGG
AGTGTACGTACCCGTCAAATTTACGAGTAGGACACTGCGGTCTCACGAGATCGGGTACGACATTGTGGAGAAGGAAGTACTGGCTCTGCTAAGAATCCTC
GATAGCTGCTTCACCATGCTGAGTGGTCGACACATCCGAGTGCTCACCAGACACACGACTCTCGCATGGCTCTTCCGCGCGAAAGGCTTGAAGGGACGGC
TAGCTCAGTGGGCGGCGCTGCTCTCCCCCCATTCGCTAGAGATCGAACGTTTAACGAAAGGCGAAGATGAGCTACTAGGTTTGGTTGCCGCCAGTATCAC
TCCGCGCGCAGAGATGGATGCAGCGTTGGAGGAGATCTCTCCGCAGAAGAAGTCGACGAGAGCATTGGCTATCCCGATGCCGACTTTTACGCCCGGAGAA
AACGTTTGCGTCGTCAGCTTTGACGGATCGGCCAAGCCGAAACGAGTTGGTGGAGCTTTCAGCGCTGTGGTATGGGATGCTCCTGGATGGAAGGTTGTCA
AGGCTGAATCTGGCTATTTACCGGACCTCACTGTGAACGAGGCCGAGTACCATGGCCTCCTTCTCGGACTTCGTTTGATTGCCGATCTCCAGATCGACCG
TCTCATTGTGTGTGGCGACTCCAATTTAGTCATCCGCCAATCGGGACTCCAGCTCTTGCGTGAGAAGGCCAGAGTGATTTTGCGGTCTTGGTCGCAATGC
GAACTCATCCACGTAAAACGCGATTGGAACCAACCCGCGGATATGCTGGCGGGACAGGCGCTGCAGCGTGGTGCCGGGGTAGTTGTCGAGAGTCACACCG
ATTACACGGACCTCGAGACCTTGAATCGGCTGAACGAGCTCCTCAAGACGCGCGAAGAACGTGACGCCCATCCGAAGATAGGCGCTGTCACGCGAAGCCG
ATCTTGTACTGTCGCACCAGCCGTGTTGCAGGAAGACGTCGTCAAGCAGCTGCGCTTGGAACGTATTTGCCGTGCTCAAGACGAGGAGGTGTGGATCTGG
TCACTGAAGTGTTTCCTGCACGGTGATCTCTCTCAGATCTCGAGCCGTCAAGCCAAGACGTGCAGTAAACTGGCTGACAGTTACGAGGTCGACGAGCATG
GCCTCTTGATGTACTGTCCAGTCGAGGGGCGCGGTGGTGATGTCGAGGACCGTGGATCTATGGTGAAACTGGTAATGCCGAGTACACTCCACGAATATCT
CCTGCATCATTTCCACACAAGTGTGGAGGGAGGTCATCAGGGAGTCAGCCGAACATTCCAAAAGCTTCGGAGGCATTTCTACTGGCGAGGTATGTTCCGA
AGTGTGCAGAAGTATGTCGGGGAGTGCGTTGACTGCGAGACGGGAAAAGGAAAACCCACCTTGCGGGGGCGATCGCCGGGCAATATCGCCGCTAATTACC
CTTTCCAGGTCGTGGCTATGGATCATATCCCCACCCTCCCGAAGTCGTTCAAGGGCAACACAGAGCTCCTAGACTTCGTGGATCTCTTCACCGGCTTCGT
TGTGGCAAAGGCAAACGCGGACAGGAC