Description :
From Genome Similarity Track
Location :
Scaffold_23:1158939- 1159985
Sequence
1046 bases(100 bases per row)
ATTGTAACGTGATTTGTCTCATGAACTTAAGTTGTCGCCAGTCGTGTTAATGCAGCACAGAAATAGAAAGCAGTGTGCTGCAGATTATGCCGCGTTGCAT
GTCGCAAAGGACCTAGACCAATTCTGTGATCGGTGAGTATCGCATTGATTTCCAGCCTCGTTCGATTTAACTGTTGCAGCTACGATGCTTCAAGCCACTT
TTTTAAGGCATGTTTCTATTGCAGTCTACATGTCCATCTCATTCCCACCGTGTCCAACCGTCACAAGATGACTTGGTCATCTGCAAAACACTCTATAACT
CTCTCTTATACCAAATGAGCTCAACCTCCTTGAACTTCACCGGATTGTAGATACTACAGCTACATATTTATTTTTGAAGATCATCTCCAGCCTCATCAGC
AAATGTAGTGAATTACCTCTACCAATTGGTGTTTGATTTTGCTAATCCGAATCGATACTAATGAATTTTACACTGTAGTGTCTGTTCCACCGCTAAAACA
GCGGTGATCGCTGCTGTTCAGAACAGCTGGTTTTAGTGTCAAGTGTAGAGTAACGCAAATATACACTAATAATATAAAAATACGGTATTCCAGGCTTAAG
TCGTAGACTAGTTTCTTTAATTTGAGCGTTTCGGACGGTTATATTTTTTATCTATAGCTTGGCTTATAGAACGAGGTGAGGCATGCTATTTAGATATGTT
TAGCCAATCCGATAGGTAAACAACTGGCATGTGACGCGGTGCTAAATTTCCGAGCATGTCGGTAGGCTGTCATACAAGGAACTACGATTTTCGGATACAC
TTTTATCTTATTTTTAGTATGGGCAAAAATGATTGTCCTAAGCGGTCATCCAATCAAGCTCGCTACTGGCTTCATTTCAGTATGGGACGCGGACCACCCA
TCAGTGACGAAGAGGGAGGAATAAGGGCCTCCACGAAGCCAACGTGGGGTGAGAGAGATCGGTCGCCGCTTTAAGATGTCGCCGGACAGCGTGAGCTACG
TACTGCGCACTGAAGACAAGCGCGCGGCAGAACCTGGCAGGTCGAA