Description :
From Genome Similarity Track
Location :
Scaffold_444:11589- 18791
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_444-fgenesh-gene-0.1Microtubule-associated protein
Pytve_DAOMBR484maker-pve_contig_444-snap-gene-0.10Microtubule-associated protein

Sequence
7202 bases(100 bases per row)
AACTAGTGGCAACGATGGGGAACACGCTGATCCTGACCGCGATCCAGGACCCCGCGGCCGTCGACCTGGCCGAGGGGATGTTGCCCTTCGACAACCTCAG
CGTGCACGAGGTGGAAGCGTACTGGCGAGCGTTCTACGACTACGCGACGTCCTTCGCGCTCTCCCGAGCTCAGTTTCGGACAATCTGCTGCAGCGCAGCA
CGCACGCTCCGGCCTCAGGGATCGACCACACGAGCGACTTCAGATGCAGACCGAGCATTCGACCTGTTTGCGCGACGGGTACCGACGGCGCAGCTGACGC
GACGAGCGGACATTGCAGCTGATAGTGTGTTCGATGCCTTAGAGTTCTATTCGTCGATCGCATTTATCGCGGCGATCCCGCAAGACGACAAGGTCGACCT
GCTGTTCGACTCTTGGGATATGTCCGAGGATGGAGAGCTGGACTTGGACGAATTCACAATCTCGCTCAAGTCGACGCTATGCGGTCTCGCAAAGATTCTC
CTGCTTCGTGACAGCATCCCAAGCGACTACCACGTCCGCGGCGGCACTGATACCATCAACTTTCGTAGAGACGGCGACGTCACACTGGACGAGGATGCGC
TCATCACTCTCGCAGGATCGATATTCCGAGATATTCAAGGTGGAGGGTTGCCGTCCTCTTCAACCGCCTCGATCAACTGCGAGCAGTTCCGAGAGTACTG
CGCGACAAACCAGCGCGCGAAGGCGATCTTCGAGTTGTTTGACCGAGTCGCTGGTAAACTCGACGCCGATGGCGATGTTGCAAACGATTTTGGCTGGACC
CATAAGGGAAGTGCAGACGCTGATGACCAGAAAGCTCGTCAGGACGCAGATCCGACGTTGATGATAGCATCTTCGACGGATCCGGGGGACGAGTTTCTTG
CAGTCAAGCCGTGGAAAGGAGCGATTGTCTGTCCGACCAAATCGCCAGTTGTATCTCGAGAAGCACCCGCAGTTTCGATTCGACTTGACTGGATCCACGG
GTACAGCGCGCAGGACAAGTGCGCCAACAACCTCCGCTATGCCACGACAGCGAAGAGCTGCGTGTCGGGCCGTCCAAACGAGATTATCTACCCAGCCGCC
GCCGTTTGTGTCGTTCTCGACATCAAGACGATGAAGCAACGTCACCTCCTCGCTCATACAGACGACGTGCTGTCGATTTGTACCCACCCCTCGCTGCCGA
TCGCAGCGNNNNNNNNNNNNNNNNNGAGATCGGGAAGCAGCCCAAAGCTATTGTGTGGGACATTGAGACCACTGAAGTGAAGTGCGTGCTTCATGGATTC
CACCAGCGCGGAGTGCTGCTTATCGCATTCCAGTCCGTGGATGCACTCATCACAGTGGGAGGCGACGAGGACCACAGCATCGCTATATACGAGTCGAAGG
ACTCTTGGAGGTCGGCTACGCTCAAGATCACCTCAAAAGGCAACAAAGCTGTGCCATTCAGCTTGGCAACGCAGTCGATGGCTGGCTCCTCGTCTTTGGC
AAAACCGTTTGCGATCTGTGGACAAAAGTTCATCGATTTCTGGACGGTGGAGAACGGAGCTCTGACATCCAAGAAAGGACTTCTGGGACGCAAAGGAACG
CAACAGTTGTTCCTGGTGGCTGAATATCTGTCGAAGAGTGGTGGATTGGTTGTCGGCACAAATGACGGGATGCTGTACCTGTTTCCAGGACGAGAGCTGG
CCTCGTCCGTCCCGGCGCATAAGGGTGCTGTGATCTCTCTCTATTCCGCAGGAGGCGGAGGTGGTCTGCTGTCGGGAGGCAAGGACGGACAGATCATCAT
GTGGGATGACAACCTCAAGCAAGTCGGAGGGCCATTCTCGATCAGCGACTCGATTGCTGGATCCCCGCAAGCGCCGTGCTCGCTGTTTGTTCGAAGTTGC
TGCTTCTCGCCCGACAAACGGACGATTCTAGTCGGAACACAAGCTTCAGAGATTTACGAACTGGATGCTCGCACCGGGAAGGGTGTTCACTCTGGCGCGC
TAGTCAGCGGACACTATATGGGCGAGCTCTGGGGATTAAGCGTGCATCCAAATCAGCAGCAATGCTGCACCGTAGGCGACGATCAAACGCTTCGTATCTG
GGATCTGGCGGCACATAAAGAGCTCCGGTCTGTGCGTCTGGATTGCCCAGCGCGAGCATGCGCATACTCGTCAGATGGAAAACTGATAGCGGTTGGACTG
GGGAGTTCTGAGGGAGACCGGCCGCGACCAGCTGCCACTAAGCGTGGAGAAAAGTCTGCCAGCAGTGACTCGAAGCGAGAGCGTCCGAAAGGTGGCTTCA
TCGTGTACAGCGAAGCCAACTTGGTGAAAGTCAAAGATCCGTGCTACGATCCAAAGAAATGGGTGGGCGACCTCAAGTTCTCTCCAGATGATCGAACGCT
CGCTGTTGCCAGTCACGACGCCAAGGTGTACTTCTACGATGTGCTGAACGGGTTCGCGCGACGGCATGTGTTCAAAAAGCACTCTAGCTACATCACCCAT
TTAGACTTTTCGTCTGATGGGAACTATCTGCAAAGCACTTGCGGAGCGTACGAGCTGTTGTTCACAGACGTAAAATCGGGAGCCCACATGACAGCCGCAG
CGACTTTTCGTGACGAGCGCTGGCACACGATGACCAGCACGCTGGGCTGGTCGGTTCAAGGCATCTGGGAACCTGAGAGCGATGGAACCGACGTGAACGC
TGTGGATCGATCCAAGAACGGCAAGTTTCTGGCCTCCGGTGATGACTTTGGCAAGGTGAAGGTGTTTTCTTATCCTTGTGCGATTGAAAAGGCGTCGTAT
GTTGAATTGCGCGGGCATTCCTCTCACGTGGCTAACGTCCGGTGGTCGGCGGACGACGCATACATCATCTCTGTTGGCGGAAACGACCGCTGCATATTCG
TTTGGAAGCACAACAAGCAGCCAAACAGCTCGTTCGAAATCGTCGAGCAGCCATCGATCGAACCGCAGCCGGACGATGTTCCGCAGTCGGCCAAGATCAT
GTCGCGCGCGTTTGAGAGCGAGGATTTCGAGGAAGACGTCGGCGACGAGTTCATGGCAGTCAAGCCTTGGCTCGGAGCGATCGTGCCTCCAACAAACGCC
AAGGCACCTCCGTCCAGCTCTTCGTCTCCTGATGCTCGACTTGAACTTGAGCAAATTCACGGGTACCAGAGCCAGAACGCGGCCAACAACGCTCGTTACG
ATGGCAGTGGCAATGTTGTTTACCACGCCGCTGCAGTTGGCATTGTGGTCGACAAATCGCCCCAAGGTGGTCGACAGCGTTTCTTCATGGGTCACGATGA
CGACATCGTCGCTCTCTGCGCGCATCCTAACGGGAAAACGTTTGCGACTGCGCAGATGGGCAAGCGACCAAAGATATTTGTGTGGAACTCCGACAACTGT
GCTGCAGCGGCGCCGTGTTTGGAGGGTTTCCACCAGCGATCTGTGCCTGCGATTTGCTTTTCCTCGGACGGATCCAAGCTCGGCAGTGTCGGTGGCGATG
ACGATCACTCCGTTGCCATTTACTCGTGGCAGAACGGCATTCTTGTCTGCAGTGCGAAGGGCGAGCGCAGCAACGTTCGCAGTATTTGTCACCACGCAAA
GACGCAAGAGTGGGTGACATGTGGAGATCGCCACATCCGATTCTGGAAGGAACAGGGCAAGAACATGACGTCGAAAAAGGCGACATTTGGGATAGTCGCG
CAGAAGAACGGGTCGCTGCCATCCGCGTTTGAGTGCACTGTGTCTTTCGGTCCAGCAGTAGTTGTCGCAGGTTCGAACGGAACGCTGTATGTGTTTGACG
GCTCGAACGAGGTATCGCGCTCGGTTGAAGCCCACCCCGGTGGAGTATTCGCCTTGTCCGTGACGGATTCTGGTCGTGGTGGCGACGGAGGCGAGCTCAT
CAGCGGCGGTAAGGACGCCAAGGTCATCATCTGGAGCTCGCAGTTCGCGAAGCTCGTGACGATCAGCGTGAACGAGGTGCCGCCGCCTTCGTCAACTGCG
ATGTTCCTGAACCCTGTCGTGCGCAGTGTTCATGCTGCCAACCGTTCGTCGCGGCTACTTTTAGTCGGTACGCTAGGCAGCGACCTGGTCGAGATTGACG
CAGGCAGCAGCTCTCGAGCGACAATGCGTGTCGTCACACAAGGACACTACCACATGGAGCTGTGGGGCTTGGCGGTGCACCAGACGAAACCAGAATACTG
CACTGTGGGTGACGACCAAACAATTCGGGTCTGGAATGCTGAAACACAAACGCTGCTTCGCATGAAACGCATACGGGGACAAGCACGGTCGTGTGCGGTG
TCGCCGTCAGCAGATGTCGTGGCAGTCGGGTATGGTGGACGTCATAACCCCAAGGCAGCCAAAACTGCCGACCAGAGCGGAACCATCGAGCTGCTCGACT
ACAACGACTTGTCAAAGTCAGTGTTCCAGGACAAGCCGTCGAAACAGGCGATCAGCGAGCTCAAATTCTCGCCGAACGGCTCGACATTGGCCGTTGGATC
GCACGATCGCTGCATCTACTTGTATCGCGTGCAGGGCAAATACCCCGACCTCAAGATCACCAAGACTGCGACATTTTCCAAACACCAAAGCTACATTACC
CACTTGGACTTCTCGTCTGACGGCGAGATCATCCAAAGCAACTGCGGCGCGTACGAACTACTGTTCAGTCAGGCTGCCACTGGGAGGCACTTGACATCAG
CAAGCAGTGTTCGCGACGTCGACTGGGCGACGTGGACTTGCGTCCTCGGCTGGCCAGTCCAAGGCATCTGGCCGCCGTGTTCGGACGGAACAGATGTGAA
CGCTGTTGCTCGCTGTTCCAAGAAAGAGCTCCTAGTCGCCGGAGACGACTTTGGCCACGTCAAGTTGTATCGCTACCCTTGCGTTGTCAAGAACGCGAGC
GGCATCGAGTTCAACGGCCACTCGTCCCATGTGACGAATGTTCGATGGTGCAATCGCGACAAGCACGTAATCAGCACCGGCGGCTTGGATCGATGCGTTA
TGCAGTGGAAGGTACTCCGGGATCACGCAGAAGATGTGGTTGTGATGGAACCAATGAACCTTGACGACCAACCAGCTCAGCCATTTGTGGGCAGCAATGT
CGACGAGATGGACGAGCCTGCTGGAGATGAATTCATGGCCGTCAAACCCTGGATTGGCGCCATCGTCGCGCCAAGCAACGCGTCAGTTCCGAACGCGCGC
GAGCCAGACGTACGGGTCGAACTCGAGTGGGTCTACGGCTACCAGTCAGAGCTGGCAAGGCAGAACGTGGTCTACAACCAACTCGGAGAGATCGTTTACC
ATACGGCTGCTGTCGGCGTCATCTACGATCCGAAGAGCAGCTTCCAGAAGCACCACATCGGACACACGGACGACATTGTGAGCTTTGCTGCTGGTGGAGC
AACTCGCGCGCTGGTCGCGACGGGGGAGCGCGGTAAGAAGCCGTCGATCCGAGTATGGGATTCACACACTGGGGAACTGAAGGCGGAGCTCAAGGGTGCG
CACTCGAGAGCGGTCTTGTCCGTGGCATTCAGCCCTGATCTGACGAGATTGGTGAGTGTCGGGGCTGACGACAACCACTCCGTGGCGTTGTGGGAAGACT
CCAGCAGTGGGTGTTGGACAACGCCTCGACTCGTGGCGACGGTCAAAGGAGATCGCGGCGTGAACATGTTCGCCGGCTTTGGGTCCACGCGCGACGCTTT
CGTGACTGGCGGCGTGAATCACGTGTTGTTCTGGACGATCCAAGGGAGTAGCAACATCGTGGCGTCCAGAGGCCGAGTTGGCAAGCAAGGCTCGCTGCAG
CAGTTCGCATCGGGCTGTGCGTTTGGCTCGGCTGACGAGTTTGTGACAGCCACGGCTGGTGGAGAGCTGTACGTTTGGAAAGGCAACCAGCTCATGAGGA
CCGTCAAAGCGCACGACGGCGACGTTCGTGTCGTGTCTGAATGCACCTACATGGATCCTCGGGGACAAGCGATCTCGGTTCTGCTCAGCGGTGGCAAGGA
TGGACGCGTCATCATGTGGAACACGAGCTATCAGACGCTCAAGAGCTTCAACGTCGCAGACGTGGGCGGCCATTGGCAGTGTCTGCGCAAGGCCATCAAC
AACGTCTTCTTGTCCGGCGACGGCTCCAAGCTCCTGGTCGGGACCTGCTCGAGCGACATATTCGAATTGGACGTCGCCACGGGGGCGATGTCGAGCTCTG
GTCCGCAGCCTGTTGTGTCGGGTCACTTTGCCATGGAGCTGTGGGGTCTCGCGGTGCATCCTTCGCGGCGACAGTTTGTCACGACGGGCGACGACGCCAC
ATTGCGAGTTTGGGACATGGACACTCGCCGGCTCTTGCAAATGATACGCTTGCCAACCAAAGCTCGTGCCTGTGCGTATTCAGCGGACGGCGAGCTCGTG
GTAATCGGCTTCGGCGGCGACAATGGCGTCCGTCGTCGCGCACCGAAGGCCAAGGCAGCGGCAGGCGAGACGAAAGTGCAGGATGGCGGCTTCAGTGTGC
TGAGCGCTCGGGATCTGGGGGTATACGCACCACTCTTTGAAGACACCCCAGCCAAGGAGTGGATCAGCGACGTCAAGTTCTCGCCGTGCGGACAGCATGT
CGCGATCGGCTCCCACGACAACAGCGTCTACCTGTACTCGGTCGACAGCAGCGGCGGACGAGTAGCGCTCAAGAAGCGGCGGCCGTTCAGCAAGCACAAC
AGCTACATCACGCACCTCGACTTCTCGCACGACAGCCGCTACGTCCAATCCAACTGCGGCGCGTACGAGTACCTCTTCTGCGACACCGCCACATCCGAGC
AAGTCAAGTCGGCGTCCGCGCTCAAGGACGCGCAATGGCACACATGGACGTGCACGCTCGGGTGGCCCGTGCAGGGCATATGGCCCGCGTGCGCCGACGG
CACCGACGTCAACTCGGTGTGCGCATCGGCGGCGCGAACGCTGCTGGCCGCGGGCGACGACGCGGGCCTCGTCAAGCTTTTCCGCTACCCGTGCGTGCTC
AAGGGGGTAAGTAACTCGACCTGTTGCCCTGTTACCGGTCGATGGAGAGCGCTCATGTGGTTACTGTGATGACAGTCCCAGTTCGTGGCGTGCCGCGGCC
ATTCGTCCCACGTCGCCAACGTGCGCTTCAGCTGCGACGACAAGTACGTGCTCTCGGTCGGCGGCAACGACCGCTCCATCTTCCAGTGGAAGCTCTCGTG
AC