Description :
From Genome Similarity Track
Location :
Scaffold_60:115840- 127302
Transcript NameFunction/comments
Phyci_229335Hypothetical protein
Phyci_229479Hypothetical protein
Phyci_93921Hypothetical protein
Phyci_229289conserved hypothetical protein
Phyci_9226conserved hypothetical protein
Phyci_116241Hypothetical protein

Sequence
11462 bases(100 bases per row)
CTGCGTCATCGTTAGAATCCGAAGACACTGCTCCCACCTGCAGCGATTGAAGGGCAAAGTTCTGGAGTAACGACTCAACGATCGATTCCTTGCGCTCATT
CAGAAGATGTCTACGAGTCGAGTTAAGCTTTCGGTCTCCACGCAAAAGAGAGCACAGGGCACGCAATGCGCCTAGCTTCCGTCGGCCTTCATTAGCACCC
AGCTCCTGGATAATCGTTGTCAGCAACAGACGGAACTCGTCTTTGTTCGCGCTGCAAACCACAGCTTGCAGCGCTTGCTCCGCGTTATCTTGTTTTAACG
CATCCGCGTCGTCGCGCGAAACAAGTGAAAGTGCCACAGCCAGTAAGCATCCATATGTCTCCAGAGGAGTCACAAATGAACGGAAGGAAGCGTACTCCAA
GCAGAAATTCGTGTAAAAGGCCCAAGCCGCGTCCCGGAGATTGGTTTCGTCCAGGGAGTCGCTGGTTGCTGTAACCACTTTCATCGAAGCTGCTAAAGCA
CCTCCGACGTGCTTCGTTAGCAAAGCTAACACTTGACCCTGATTAATCGTTTTCTTCTGCTGGTATGCCTGCTTCTGCAGCACGGACTGATATTTAAGAA
GAGCAGTTAGCACTTCAAACGACAACGGCTCATTCGACGCCTCGCACACGTTTTCACGTGTGGCAATATCAACAAAGCTCTCGACAAATTCTTTCTCATC
CTTCGAAGCATCTGATGTAGCGCCACGGCGCGTAGCCAACGCTTCCAGGACAATGACAGCACGCTTAAGCTTTCTTAAAGTCTTGTCCCATGAGTTTTTC
TTTGCACTCTCCTTAGTGCTGAGGACACTGCAGAGCAATTCGCCGACAAACGTATCGTCACCGATGTCCAAATAGTAGCAGAGCACTTCAGAAACTAATG
ACACGCTAACAGCGTTGTCGACAGCAGCTTGAGAGATGACGAAGCGTGCTCCATTGCGCAGCTTCTCCTTTAAATGAGCATTGCCCGACTTGTTCACTTC
AATCCCGATGATCTTAAAATGCTGCTGAATCCAGACCAATACAGTCTGGCAGATTTCAGTCGTACCCTCAGCACGCAGGTTGGACACGCGGATAGCCTTA
TACAAAGACAAAGCAGCGGACAACAGATCGCCGCTATGTTCAATTTTCAGATAGCTGGCCGGAATCTCAGACAAGAAACTGAAGAAGTGCATAGCCTTCG
CTACGTTCGCCAGGGAGTCACGTTGTACTTCATCAACAAATTGCTGTCCCAGGGTAGTCAGTGAGGTTGGTGCGACCTTGCGAAGACTCGGAATCTCATA
AAATCCTGCGTCGCAAACAATTCGCCTGGCTGAACCATCCAGCTCTCCAGAGGTGGCTTCACCCAGGAAAGCGGTCAGTATCTCACGGAGAAAGTGGTCG
CACTCCTCACTACTCGCGCTTTCCATCAGTTCAGGAAGGTGGAAACTAACTGCTTCCCAGCATTTCCATTTTATCACATACTCAATGACCAGACGAGTCA
CCTGTTCCCTTCCTTCGCGAGAAACCTTACCAGCATCATCAACCTCGATGCTTGAAGCTCCCATTTTACGCAGCCAATACACGCAGAGTTTAACGATTCC
AGCAGCACCTAATCCGTGGCTGGTGCTTAATTTGTCTGACACGCTATCGGTAGACTTGGCCTTGCTGTTTTTCTTTTTCTTCTTCGGGCTAGAAGCGCCC
AATAGTTGCTTCATCACGCTACCAAATCGATCGCCTTCAAGTTTGCCAAACAACTGATCAACCGTTTGCTCGCGAACGGAAGTGTTTAAAACCGAATCGA
ACATCAGCAGTTCTCCAAAAATGCAGAACAGCTCGCGCTGGTAGGACGAGAACGAACCAGTAACTTGTGCTAACTCATCTCCAAATGAGTATAGTAGTTT
TTCGTGCGTGTGAGATACAAGCCCCAAAACCTTTGATCGGTTCTGAGGTACCACGTGGATTTCTTGCACGAAGGTCTGAAAAAGCAAGCGCGCAACTGCC
ACTCCTTGCGCATTGTGGATATTATCATCACTTGAAGAAAAGGAGGCAATCTGCTCCACAAGAAGTTTCCACAAAACATCCATTTGACCTGGTGGTAAAG
CCATAAAAGCTTTACGAAGAGTAGTTTCGCATGACGGGAACGCAAACAGCTTGTACACTCCTTCATGAGCCCGCTGAATCGTAAATGCTGCCTTCAAAAG
TGCATCCAGAAGACGCATGGAATCGTACGCATGAATAAGATCCACCACTGCAGCACTGGCTGCTCCAAGGATACCATCAGTGTTTCCGTCGTTTCCTTTC
GCTGAGTACTTTCGAACAGCCTGCAGTCCCAGCAACTCGAGAATTGGCACGATACAACAGTTGACAAGGTTGGGAGAGCATCGCACAGCGCTGGACACCA
CTTCGCACTCCTCTGACGCTCGTTCAGCATCGCCAGACACCTCACCACCGTGCTCGACGTCAAGCACATCGAGGAACGAAGAGAGGACTTTCTCCATAGT
CAAAAACTGCCCGCGGTCCTCCGTATCCTCCGTCACACGATAAACGTCACATTCGCACAAAGCTCGGAACAGCGCGTTGTACAGGGTCACCAGCACCGGC
AGGAACGCGTTCTTGTTCTCCTCCTGTTGGAAAGCTGAGAAGGCCACCGCGCACAGCTCGGACCAGAACTTGAACGGCGAGTATGTCGTCGACGTCGTCG
CAATCACGATAGCAGCGCGCTTGCGACTCGTCTTCAGATCCGTCTTGGTGTCCTCGATCTTGGTGCTCGCGGCAGCGCGGATGCGAGCAGCGAATCCACG
CACGAGCACCTCAAAGAACCCGCCAACCGAGGCCTTGAGCTCCGCCTCCACCTGCTTGTCCGACAGCAAGCTTAGCAGCTCGTCGAACAGGTTCTTCTGG
TACGACACCAGGCCCGACGCCTTGGCGCCTCCGGCCTTGCGTCGCTTCTTCGTCTTCTTGTCGTCGTCCTCTCCCTGCTCTGCACTTGTGTCTTCGTCCT
TCTTCCAGATCGCCGCGTGCACCATGGCGCCGTCGTACTGGCGGATGTGCTCGGCATCAAAGAGCGCGTCCTCCACGACGCGATCCAGCAGCTGCGTGGC
GGCCTCCACGCCGGGCACTTGTTGCTTCTGCAGCTTCACGAGCGCGTGGCGGTAGGCCACGACGTCCCTCAGCGACGTCTTGGCGATGGCCAGGAAGACC
TTCTTCTTGTTGGTCTGCGTCTTCTGCAGCTCCTGGAACACGAACAGCGCCGCGTGCACCACGTCCACGTACAGCTGCTGCTGCTCTTGTCTGCCATCTT
CCTCCTGCAGCTGCAGCTGCTGCAGCGCAGCGAACGCCGCGGTCAGCGCGCGCTTGAGGAAGTCCGCGTACACGTTCGTGGGCGGCCGGTACATCTGGAA
GCTGGCGGCGGCGCCCGGCAGCCCGAACAGGAACAGGAACACGTGCTTCACGTCGCGCAGCGTCTGCAGCTCGTGCTGCGTCTCCAGCGCCTCGGCCAGC
GCCGCCAGCAGCAGGTTGCACGCGCTCAGCGGCAGCGTCGCCGGCTGCGCGTCGCCGTCCGCGGCCAGCGCGTTGAGCGCCAGCTGCAGCAGCCGCAGCG
GCTGCTCCAGGCGGTCGGCGGCGTCGCGCTTGGCCTTCGTCACGAGGAACACGGCGAACTGCAGCGCCTCGGCCGCGATGCGCGCGCCCGGCAGGTTGAA
GGCGTGTGCGGCGCGCTGCAGCGCCGACTGCGGGCCCAGCGGCGGCGCCAGCAGCGCCAGCCCGGCACGCAGCAGCTCCGCGGCGTCCCAGGAGAAGCGC
TCGGCGTCCATGGGCAGCGGCGACTTCAGGTGTGGACCAGTCAAGCATGGCGCACCCCAAAATAATAGACGAGCGACCTAAAATAAGACGGATGTGGACC
ACGTAAAGGCAACTAACCCAAACTAAACTTCAACTTGCCCAAAAGAAATGGACTCCATCATGGCTACACTTTTAAAAGTGCAGTGGACGAGTATAATTAG
CGGGGCGGGGAGTCATTGTTGAGCGGGTTGAGCTCTCTCTACTGCAGCGAGCGGCATCTACGTGAGGAACCATTCAGGAGCTACTGCCCACCGTTTGCCG
CTGCGGCCAGTCGTGGTCCGACCCGCGCGTGCCACACTTTTGTCAACTTATTAACGGCGAGTCCGTGCCGGTACCTGCAAGGGGTGGGTCAGCAACGCTA
GCGCGGTCGTCTTCCAGGAAACGCGTGATGCCAGTTGGACTGAAGGCAGCCGCTGAGCTCAAAGTGGTCACCACGATGCCCGAGAAGAACCTAATGCCGG
AGACTACGTCACCTTCACTCCCTGAGTCAAAGTCTCAAATTGCTGCACCACCTGTGGTCCGACGAGGCGGGTCGTCGGAGAACATTCAAGTTTTCATCCG
CATCCGTCCGCTAATTGAGCGCGAGAATTCGCAGGAGCGATGTGCCGGGACCCACTCGATTCGCGCAACTGACCACCAGGTTTGTCCTAGACTGCATTTT
TGCTTCCGATCTGCATGTAGAGCAAGACTGACAAATGACTGTCTAACAGACCATTGAAGTGCGTACATCCGAGTCTACTATCAAGTGCGCATATGATGCT
GTCTTCGACCACACGTTTTCGCAGGAGCAAGTGTACGACCGTGTCCGTGAGTGCACGCAGTCTTTTCTTCAGGGTTTCAACTCCACGCTCTTTGCCTATG
GTCAGACGGGAAGTGGCAAGTCATTTACAATGTTTGGTGCCGAGACGGACCTCTCGCGTTATCGCCCAGGACTCCAGAATAGTCAGGCGGGTATCATCCC
GCGTGCTATCAAGGAGATTTTCGCTGCCACGGTGCAAATGGAGGCAGACGCTCAAGCAACCGTGTTCTGCTCCTTCGTTCAAATTTACAACGAGCAGATA
TTTGATCTATTGCGAGATACCCAAATGAATGCACCTCTGGAGATTCATGAAGACCGAAAGAACGGCATATTTGTCGAAGGATTGTCCGAGTATGCAGTAA
GGAGTGTAAGCGACTGTCTGCAGTTACTGCAGTGCGGTGAACAGAATCGCGCTGTGCGGTCAACGCACATGAACCAAGTGAGTAGTCGAAGTCATAGTGT
CTTCCAACTACTACTCGAGCAAAGGCGGAAGGACGGCACCGTTCTCAAATCCAAGTTTAACCTGGTCGACCTTGCCGGCTCTGAAAAGTGGAATATGGGA
GCTGAAATGCAGGAGCACCACATATCGGAGATGACAAATATCAACCTGAGCTTACATACACTTGGCCGATGCATAGCAGCCCTATCAAGCAAATCGACCG
GCGGGGTAAGCCATGTACCTTATCGCGACTCGAAGCTAACCAGGCTGCTCCAGGACAGCTTGGGTGGCAACACCAAAACCAAAATCATCGCCACGCTGTC
ACCGTCGATTGATTGTGTTGAAGAGTCGATCTCGACTCTCAAGTTTGCAGATAGAGCCAAAAAGGTCATGATTATGGTGCGTGTGAATGAGCAGCGAGAG
ATAGATCCTGCCTATGTAGAAAAACTTCAGGAAGAACTTGAGCAGCTGCGCGAAGTTGTTCGTCTACTTCGACTTCCGAACAGCGCAAACGGAGATGATC
CTGACCATGATGGGGATAACGGCAACAATAACGAGATCCACGATGAAGATGGTAACCAGGCATCTGCTGGGTTGAAAGCGCGAGTTGTTCGACTGGTTCA
TGAAAATACCGAGCTCAAACACCAGAACGAGAAGCAACAGAAGGAATTAGAAAAACTGCGACGCGAACAATCTCCTCGAGCAAGCCCTATGGCCCTGAGC
GCTGCTGTTGACCCGCAAATTCTACAAGCAAAACAGGTATTGTAGGCATCATGTTCAATTGTTGTTCGAGATTATCGTCTAACAAAATCGTCGCTCAGCA
CTTCGAAAACACGGTTCGTCAGCTAAAAGATGCCTCGGATCGTTTTTTCCGCTTTGAAATCGAGGAAGAAGAGCTCAAAGCGATTCATTCGCGGCTCTTT
CAAGGATTCCAGGGTGGTGCTAGCAACCCGCCGTTGCCAGTATCTCGCTCCCCACTGTCAACTGGTGGAAGAACACTTGGAGGGGGCAACATTATGAAAC
CTCGACCTCGTACGTAACAGGCAACTTTGGTGCAAAACTTGGATCTGAGTGCATCTAACCTAGTTTTGGAACCTGCAGCGATGAAGCTTAGATCATTCAG
TTCGTTCACTTCGCCCGGATCAGCAGCAACAAAACCTAATGCCCCGATGGACATGACCTATCGGGTACGAGGTCGCTCATCAAGTATTGACGCCAATGGA
AATGGTGAGTGCTGGAAAAACGACATACAAGCGGCTCCCCCTATGACAGTCGAAAAAGAGCTGGAACTGTCACGAAAGGCTATTGAGAAGCAAACAAAGC
TACAAAACTGGCTGATCGAAAAGGAACGGAGAGAAATTCTCAAACTGCAGCAAGAGCAACAGTTCGTCGACGAGCAGCGCCGTTACGCAGCTGAGAAGGA
TGCCAAGTTCTTTAAGCGGGCCGCAGCAACTAAAAAGAAGCTGCTTCTAGCCACTGCAGCTTCGGCGTCTGAAGAACTAGATTCCCCTAGTAGCAAACCA
GCAACAGCTGAAACGTGAAGACATGCATCTCTATTTATCACGCAGAAAAGTTACCAGCGTAAATAAGCTCGGCTAGGTCCTCAACAAAGAGAGACTTTAG
CCATGGAGTTGTTGTTGCCTGCTTGATCTAAAGTACGTTGAGTGCCACGTTCTTGTATGTCTTGCCCAAATAGCTCACGACAGTGATTGTTTTCTGAGGA
CGGCCGATGGAATCGGTCGTGACCTTGGCCTTCTTCGAACCCGGGGCACTCTCGAACGCTAGAGCTGCGTGAGCATTGGTCGAGAAGGTCACGTTGCATG
AGCCGCGGTTTTGGTTCGGCAGCCAGGCAATCTTTTCCACCGCGGCGGGGACGATACAGGTATTCTTAATGAAGTAGTTCTCAATGTCTTTGGACGAGGC
GCCCTTGGGAATCCGATGCACACGCAAGCGACAGGAGCGTGCGATCATAGCCTCCGACATTCCGTTCTTCTTGCCCACTGGTGCGCTGGCGTCGTCCTTC
TTGATAGCGGCCACGTCGATGTAGGACGCTTCATTCACCGGAGGAATCTTGATGGGCGTGGGTTTAGACGGTTTAGACGGTTTAGTAGAAGGTTGCTCAG
CCTGGAAGGCCGACGCGACGAGCTGCACCGGGCCCGTGTACTCCTCCACGACTTTTATCCTCTCGGCGTCGCTGTCCTCACGCTGCTCTCTAGGCCCGTG
GAGCTCCAACGCGGAGGGGATGATCCTGCCCGTTTCATGCCTTGCAGCGTACTTGGCAGCCATCATGGACGCCTGCGCGTCGACGGTACTGTCGTGTCCC
TGGGGCATATCAAAGCCCAGCAAGAACTTGGTGAGGTCCTTAAGTCCGGGCGTTGCGCGGGACGGACTGCCGTCCTTGCGTCGGAAGATGAGCGCCGTGT
CGATCACCCGCCGGTGGTTGATGCGCATGCTGGCCAGATCGCCGTTCACCGAGTGGCCCACGACGATCGTGTCCTGGTTGATGTACTTGAGCATCTTCTT
CTGCGCCTGCGCCATGGTGATCTTGCAGCTGGCGATCTGCTGCGGCGTGATGCCGTGGATGTTCGTCTTGGTGTCCACCATGTGGAAGCCGTCCTCGGGC
TGGTGCACGACGAAGTCCGACAGGATGTTGCGCAGCATGTTCTGTCCGTCCACGGCCGACACGCGGCACAGCGCGTTGGTCTTGCGCTCGCCCGAGCCTC
CTTGCTCCGTGACGCACATCTCGCAGTCCACGGCCACGATCTTCATGTGCGTCGCCTTCTTCTTGCGCCTGGGGGTGACCCAGCCGGGCTCGTCCGCCGG
GAACGCGAACAGCTTGTCGAACTGCGCGCTCTGCTGCGTGAGCTGCACCAGCTTCTCCCACTCGGCGTCCGCCACGTCGTAGCCCACGTCTCCGCCGGGC
GCCAGCAGCTGGTTCATCACGTCGATGGCGGTGATCGTGGCCTCCTTCACGCGCTGCTTCTTGCTGGCGGCCGCATCCTCCGCCTGCTGCTGCTGCGGCC
GCTTGCGCTTGGGTCCGGCCGTCGCCGCCATGGTCACTACACTCTGCTGGAAATGGTGTCGTTCCAGGCCAGTCAGCAGCAATAACGCTGGCCATTGGAC
GAAAATCATACCGGTGTATGATTGGTTGGTTTAAAAAATGGGTAAATTAATGTGGCGCACACAGATCTCAATTTTTTTGGCACGGATCGCAGTGCAGTAC
CGTGACTGACGCATTGAAGGCGACCACGATGCTGCGCAAGAGCATGCTGGACGTGACCCAGCGCGCGACGCAGTCGCAGGCGCTCAAGAAGATCACGGCC
GGCTACGAGCTGCTGCCTGCCAAAGAGAACGGCGTGCGCTACATCTTGTGGGCGGCGGACGCTGCGCACGCCAAGCCCCGGCCGGCCAAGGAGCCCAAGG
ACGAGCAGCCCAAGGCCTTCCGCGACCCGTTCGCCAAAGAGCACCTGGAGCAGGATCTGTTCGTCACGCAGCTGCACGGCACGCACAACCTCGTGCTCAA
CAAGTTCAACGTGGTGGACGAGCACGTCGTGCTGCCCACGATCGAGTTCGCGCCGCAGGAGCAGCCGCTGGACGCCGCCGACTTCCGCGCCATGTGGACG
GCCATGCAGGGCCTCGACGCCTTCGCCTTCTTCAACTGCGGCTTCGAGAGCGGCGCCAGGTACAGCAGAGAACTATTGAGTGGCAAGAACTAGCTTAGTG
GAGATGGTGGCGGGAATTTCTGATGGGCTTGTTGTTCCGCCGCATCCTCTTTGCTGCTGCTTGCTTAGCCAGCCACACAAGCACATGCAGCTCATGACGT
ATCCCTCCATGAAGGCGATCACGGGCCTGGACATGGTGCGTTCGTTGACCGCCTGTCGATCTCTAGCTGCAGCTGTGGAGCTGACACTTGCTGTGTTGTG
TGTGCGTTCTACTTGTCCGTGATAGCCGCCGCTGCTGCACCTCATCGACCAGAAGCTCCGCGACTACCCGACCACCGAGACCGTCCAACTGCCGGAGCTC
CCGTTCTGCCACTTCCTGCACCGGATCGACCTTCCTGCCGATGCTGACAGCGAGAAGGCTGCGGCACATGTCGTCGCCATCTACGATAAGGTGCTCAAGC
AGCTGAACAGCGCGGAGTACCCGGACCGCACCGCACAGGCGACAACCGCGTTGCCCGTGGCCTACAACTTGCTGTTAACGTCGTCGTTCCTCTTCCTGAT
CCCGAGGAAGGCGCAGAGCTTCAACGGCATCGAGGTCAACTCGATCGGCTTCATCGGCTCGTTCTTCGTTCGCAACGAAGAGCAGCGTGTCTTCTTCGAG
ACGCACGGCGGACCCATGCAGCTGCTGCGCCAAGTCACGTTCCCGCCCACACTCGCGCAATGAGCAAGGGAGCGATTTTGACAAGCTACAGTTGATGAGA
GAATGGGCTGTCGTGTTAATAAATGTAGCACTCGATGAACGAGGCACAAGTTGTTTTGTTTTCTGCGTCTCGGCCGCCCTGCACGCTGCAGGCCCCAAAT
ACTAATACTTCACGTCGTCGAATAAATAAAGGAGCGGGGAGAAGGAGGAGGAGGATCCCTCCTCCCTCCCCCTCTGTGGCTCTGAAGGCGGCGAACCCCT
TCGTTCGTGATCCGTGGATCCAGAAGCCACAGGAGGCTGGTCGGCGCTGTCAGGCGCTTAGACGCCGATACCCGAGCCAAAAGTCTCCAGGGTGTGCGCC
TTCCAGCCGTCCAGGTTCATGTGGCGGTTCTTGGCGCGCAGCAGCAGCTCCATCTGCTGCGAGAAGGACTCCTCGACCTCCAGAAAGCCCAGCACGTCCT
GCAGGAAGCGGCACTCCGGGTGCCACGAGCCGGGCTGCATGCGGTGCAGGATGGCGAAGATGATGTGCAGGAAGTTGTCCATCTCCTGCTGGCGCTTGGT
CAGGTCGGCCTCGCTCTCGCCGAGGCTCAGGAACGGCATGCGCGTGAACTTGAGCCGCTCCAGGAAGCCGCGCGTGACGTCGAAGGGACAGCCGTTCACG
CCCTCGCAGCGGCACTTGCCGCTGCGGCCCGACAGCAGCAGCGACGCGTCGTGCAGGCTGCCCACACGCGCGAGCAGCGAGCGGCGGAAGCGGCGGAAGT
CGTCGAAGGAGCGCGCCACGAGCTGGCAGGACTCGCGCTCGTCCGAGAAGGCGCGGCGGCCCGGGATCAGCGTCTCCACGGACACGACGAAGGACAGGTT
CTTGCGCGGGCCCTCGAAGTGCGAGACCGAGGCCGAGAGCTTCTTGAGGATCTGCACGTCCACCTTGCAGTCGGCTCGCGGTGCGCGCTCGATGGAGGCG
CCCGACGCGCGGTGGCGGTACAGCTCGCCGTCGTTGGCGACGGTGGCGCGGCGCGTCACGGACTGCGGCGACAGCGACGGCTGCAGCGCCGCGACGTGCA
TGTTCGAGTGGCTCTGCGAGTTCATCATGGGCGGGCTCGGGGGTACAGCGCGAGTTGGCGACTGCCTTTGGCGCGAGCGAGTGGGGAGATTCCCAGTGCC
ACACGCTCAAGCAGGCGCAGGAAACCGTTGGCGTCGCTCCGGGCGGTGCGACAAATCGAGAAATGCGCTCCAGGCTCGCTTTTCTTGACGGAGGAGAGTG
ACTCGCCTTTGGGCCGCTCCCGCCGCGGCGAGAGAGCGGGCGCGCGCCCTGGCTTTTCCCCGCATTGCTATGCAGAGGCCCACTGGCCCGGGCCGGCCTC
CCACTGGTCAAAATTCGCCCAGGGCTGGGGGCGGAATTGGGCCCCGCGCCCAAAAAGATGGCGCAGCTGCGACGGCGCCTCTCGAGGTTTGAATGCCGCC
CGGCTTTGATGTTCTCGGCAAATTTTCGCAAATGAGCACGCCAGCGGGAAATGGGCGCTAAACGGACGCGACAAAAGGCAAGAATCGATGTCCCAGAGCG
CGTTTGCTGCCTTGGCAGAGCCGCTTGAAGGCTCGACTGCGAATGGGAGCCTCATCGGAGAAGAGGTGTAGCTATTATAAAACTGTGCCTTCCCTGCGTT
AAATTTGGTGCTTGCAGGCAGTTCTTTGCGTTAAAAGGAAGAGAGAATACAGGATTTTTTGTAAAACTTTTTTGGCTAACCGTCAACGTCGAACTTCCAG
GCTTCGTGTCGTTAGACACTTGCCAGCTATTGTCTGTTGCTAGCATCGCTGCCGTCGCCGTGAACCCTCAGCTTCCGCCCTTCGTTAGCGGGGGCGGGCG
GCGAAAATGGGTCCTCCTCACTAAAGTAATTCGCTAACCCAGTCCGCAGATGCGACGTGTTGCGGTCCCTGACCTCGCTCAGCTGTTGTGGCGTGGCGCG
GAAGACCTGCGCTACATGGCCTCGGCGATCGAGTGGCCCGCTGTCTTCCGACGCGGAGGAGA