Description :
From Genome Similarity Track
Location :
scaffold_85:11580- 13487
Transcript NameFunction/comments
g3105.t1hypothetical protein

Sequence
1907 bases(100 bases per row)
AATTGGTGGTGGCGGTTGCTCTGTCCATTTACCGGTCTGAAAGCCTTCGCGATCTGCTGGCTCGTACAATCGATAGTACGCCTCAAGTTTCTTCGCCGGT
TCTCTGATCTCGAACTTATTGAGATCATTGCCAACAGGGCTAAGTGAGCAAATGTGAAAACCTACTGGGACAATCTTGAGGTTTTCACTTCCACGGGGAT
CTTCCTGACTCAACGATACAAAAACACGAGCACGTTGCTCGAGTACCAATTCAAAGTGAGGGTTGTTTAACCAGGTGCTTTTGGTCACATTTCCGCCACA
ATTCGCCTCATTCCAGCACCCTTCAGATCGACGACCATGCCAGGCATCTGGAAAATCTGTTGAACGGAGGTTAAAAACTGAAATAGGTAAATAACAACCG
ATAGTCAACTTACCTATCCCAGCGAAGAAGTGCGTAAATGACTGCATCCAGGAGTCGTACGACATGAAGAACGTCCCATCATTCGCATTGATTTCGATCA
CCTCCTCTTGGGAAATCTCGTCGGCGCCCACAGTTCCTTTGGCGTTCAGAGTCATAAACATCCGCTTTTCAGCATTGGCACCGACCCGGCGCTTTAAAAT
CTTGAAAAACGTAGCTATTGCGTCCTCGTTTGCTGCGCGCTCATCGCTGGAATCGGACCACGGCCCAGTCTATCGTAAATCAACAGCATTAAAATCACAA
GTACGATACAGCGCGTGATCTCTTTCTTACCCATTCTCCCATTCCCCACGGATTTCGCAGTTTCACCAACCGAACGTATTCACCTTTTGTCGTTTTAATC
TCTGCTGCATCCACGAGAGCGTATGCATGCTTAAAGTACAGCCCGTTTCCCGCGCTTGACTCAACCGCGACGTTTTTTGAGGTGGCTAGCGGCTGAATTG
AGCACCCCATCAGTGTTCCTGACTGTTTGTATCGCATAATTTTCTCCCAGAAGGGGTCTCCGTACTTTTGCTGTGGTTTTGCCGGTGTGTACGGATTTTC
ACCAAAATCAGGAAAGCCGTCCTTCAAAATTACTTGCTCCGAGCACATTCCAGTTAAGTCATTGAGAGCGCAATCAACGAAACCACCGATTAGCGCTTCG
TAGGTACCGTGCAGTTTTGCATAGGCTTTTTCGAGCAGTGAAACCCTGTCATTTCAACCCTATCGTTAGCTCCTTATTGCAACAAATACGCGTATGTTCA
ACTTTACCAGAGTTCGTTCGGATTGCGACAGCGAGCGAAGTATGGTTTTCCTGCTTTCTTGTCGGTAAAACCAAAAACTGGTAATTGGTCGTCGATAAGA
ACGTAATTCCATACAAAATTCTAAGGAAAATGAATGATCACGTTAGCTGGTTCGAAATGAATTGAGCTCAAACTCACGAACCTTCATGAACTTGCAGACA
AACAGTCCCTTCGACTTGTGTTGATCTCTTCGCCAAAACGTTTGCTCTAATAAATCGGATCTAGTCGCAACCACACTCAATGCACCTAAAATACACAGCA
TGTCTTTAGTTTGAAGGAAAAACTCTCCACGCTACACGATGGCACTTACTCAGAAACCAGCAGTCGCCCAAATTCCCCTGTATGACATCCCCAGACGAGA
CTCCATCAGCAAATAGCGTAGCATCCGGAGCGAACACGTTGTCACTCGACGACATAGCGTAACTATCATCCCCATCGTCTTCTTGTGGACTGTCCGAAGA
AAATATTAAAAACAAATTAGATATATTCGAAACAATAGGAACAAAATTGTACACTCACCTGCTGCTGTCATCTTCTTCATTTGCGTAAATCGGTCGTTCC
CATCGAATTTTGCCTTGTTGGAGTAGACCAAGCACCCTGGCTTGGTGCTGCGACCCTCCTTTCGACGGAATAACTCCACCTGCTTTACAAATTGCTGCTG
CGCCGTC