Description :
From Genome Similarity Track
Location :
Scaffold_360:11580- 12589
Transcript NameFunction/comments
g13698.t1hypothetical protein

Sequence
1009 bases(100 bases per row)
GGAGCTTGGACACTGGCAGCTGGTACTACAACGGCAAGGCGTACCAGAAGTACGCGTCATTGTGTTTGATGGCCGCCGACAGCTCAGTGGTGGGAGATGA
CACTACACTCCTGAGTAGTTGTTTATCGAAGCTGGAGGCACTCATCGAACCTTTTGTCAGCAACACGCTGAGCGTCCCATTGGTGTACGAGACAACGTAC
AAGGGCATTGTGACAAGCCAGGTTTTCACTAACAATGATGTCAACGTAGAGTTTGGTAACGGAGTGTACAACGACCATCACTACCACTACGGCTACTGGA
TCACAGCGTCGGCCATCCTGAAAAAGCTGGATCCGACATGGTCAGGCATGGCTCAACTCGAGACGATGGTGTGGACGCTGCTCCGCGATGTGGCCAACCC
GAGCTCGGAGGACACACACTTCCCCAAGTTCCGCCACTTCTCCTGGTTTCTGGGTCACTCCTACTCGCACGGCGTGACCCCCATGGCTGATGGTAAGGAT
GAAGAGAGCACGTCGGAGGATGTGAACTTCTACTACGGTATGATGCTGTGGGGCAAGGCGGCGGGGAACAAGGCGGTGGAGGACCTGGGGAGCCTCATGC
TGCGCCTCAACGCGCGTACAGTGCGCACCTACTTCCTCATGACGTCGGACAACACGATTCACCCGCCTCAGTTCGTGCCCAACCACGTCACGGGCATCTT
CTTCGACAATAAGGCGGACTACGCGACGTGGTTCAGTGCCGAGAAGCACTGTATCCACGGCATCCAGATGATCCCTGTGTCACCGATCAATGGTCTGGTG
CGCACGACTGCATTCATTCAGGAGGAATGGGATGACATCCTGTCGAAGGAGGCGATTGTCACGGGTGACAACACTAGCAATGCGTGGTTGTCACTTCTCC
TTGTTAACGAAGCGGCGATTAATCAGGCAGATGCGCTGTCAAGGCTCACGACAGCGACCATGGACGACGGTCTCACCCGTTCATGGGCCTTGTACAACGC
TGCATCCCG