Description :
From Genome Similarity Track
Location :
Scaffold_1844:1158- 3424
Sequence
2266 bases(100 bases per row)
CACTGCAGAAGACTATTCAAGAGCGTGCAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGAAGTCACCTG
GGAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTAGGT
GGACCTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAGCTGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGAA
GCTAGTGAGACGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTCCGAGCTTTCAACCGGATCCTGGGGCAGAGACAGCGGGCAACCATGG
CATATCGTCCCCAAGCTAACGGATCGGCCGAGCGCATGGTGCAGACCACTCAAGATGTATGTTCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAG
AACGACTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGC
GGCCATTCCAGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAGGTGAAC
GAACGGCTGCGGAGTGCGATACAGGATCGAGCAGATCGACACAACGAAGACGCCCGTCCACATCAAATCCAGGTGGGATCGCAGGTGTGGCTTTATTTGG
ATCGAGTGGAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACTGTTCCGGGTGAGCGAGAAGATTGGAGAACATGCGGTAAAGCTGGAAAC
GGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAATAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGAT
GGATCCGATCGCGTCGACTTCGGCGAAGTCCTCCTACCGGAATATAGCTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATA
TGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCT
GAACTGTGGAGTATTACTCTATGATTTCTTGACGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGGGGACCCA
TGGATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACAGGAAGGGTGTGGCCAGGAGGAGGAGGATCGCTGGTGTGAGTTGGTCACATCGA
AAAGAAAGAGAAGACGAATCCACAGGGGAAGGGTGGATTAGGAGGAAGGAGTGAATGTTTATGCATAAGAGTGACGTTTTACGTGCGAGGAGTCCTGCTT
GATCTCAAGCACGAGCTTTCAAGGGCCCCAACTATACTGACTTAATTGAAACTGGGTCATTGGCGCTAGATCCGGATGAAATCCAGGCGCAGATCCAACC
GAATCCGGGACCCCGCCCAAATCCAGGTGTACGCCTGAAAAGGGTGGGATCTCGCCCCAAAATCTCAGGTGGTAAAGCCGCAAAAGGGTGTGGAATCCCC
GCCCCCCCAATACCCCGTGTTAACCCTGAAAGGGTGGATCTCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCGGATCCAGGTGTACACTG
AAAGGGTGGATCCCGCCCAGATCCAGGTGTACGCTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGCCCGGACTAGATTTCTCAACCAA
CGAGGGCACCACCAGATACGCAGTGGCAGAGGCGGTAAGTGAGCATACGGGGAAGGCGATTGCGAGATTTCTTATGGAGCGAGTGGTTCTGGTCTTTGGA
CCTATGCGAGAGATAATGATGGACGGGGCGATGGAGTTCAGCAGTCAGGCTACGGCAGAGTTGTTACAGCTGCTGCAGGCGAAGCAGTCAACGCCATCGC
CCTACTGACCGAACCTACTGGGTCTCGTTGAACGTTTCCACCGCACGTGGAAGGACATTGTGAGTTTGTACGTAGGCGAGGAGCAAGACGACTGGGACGA
CTTCTCGCCGAGCGCCCTGTACGCCTACAACTCGGCAAGGGACGCTACGCATGGATATCAGCCCAA