Description :
From Genome Similarity Track
Location :
Scaffold_111:115785- 122467
Transcript NameFunction/comments
Physo_142287reverse transcriptase

Sequence
6682 bases(100 bases per row)
TGGTAAAATACACAAAACGTCCAGCTTTCGCGATGTTGAGAGATGACTGCAAGGCTCTAATCGTCATATCATCAATATTTAGCCAATCAAAACGTTTACC
TCTCACTTATGCACAACACATCTCTGATGACAGCTCCATATCCGGGTTTTTGTGCAATTCTGATTTTTACCTCTCTTGTTTATACTTTTGCTGACGAAAA
TACACTTGATTAGGGGTAGTCAATGCCTGCAGCAGCAACTAATTTTTTTTCTCACTCAGACACGACAAATGTTTTTTTACCAATCACAAGCTGAGTGCGT
TGACCACCCCATTCACTGTCCGCAGCAACAGATCAAGATTTTCCGTCCCCCCTCGGCTTCAAACGCCCCAGCCTACGCGCTTGTCCTCTGGGATGCTGGA
AGCGTACGCTGGAATGCCCGGAGCGCCAGCAAGAGGAAGGTGGTGTCCTCTGCCTCCTTCAGGTTGAGTGTGAGAAGGCAACAGCGTGTTCATCCTACTG
CAATCGGCGTGGTAGGTGTTGATATTAGCATGAAACTCCAGTCGGCGTCTATCCGAGTTGTAGAGTTGCTGAGGTCGCGCGTGGGCACGAAGGAGGCCCA
CCTGTTGTTGATGGTCAAGGTGAGGAGACTGAGCGTGTTGAGTTTTGTTGGGGGAGGCGCTTGTTGCTCGGCCTGCCGATGCGAAAGTAGGGCTAAGTTA
GCTGTAACTAGCGGAGAGAACTGCCGTCCGCTCACTACTCTCAGCGCCTTCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCGCAGCGATTAGTGGATGCAGCTTTAGACACAGTCCTAGGCAGCTTGCTAAGGAAGACTCGAGTGTAGTATAGATACAGAGCTCGTGGAAGGGTTC
GTGTTCTCTCCGTCCCTCGACATAAATTGTGCATTGTTACATGATCGCGCTGGAGCAACGCTTGCTGGACACCAAGGCATCCGACTGACACAAGTAGGCT
TACCAGATTGGCCTTCCGAGTACTCTGCTCGCAGCGCAATCTTCTCTCGCGCGACGACCATGCTACCGTACCGTTGGTGCTCAGATCTTGGCGCCAGAAA
AAAAACGAGCTGCTGCCGCGGCTCGACCGGAACGACTTTTTGTTCCGGTCGCCGATTTTTTTCCTGGCCAATCACAGCCCCGGAAAAAAAATCGACTTGC
TGCGGCGGAAAAAAGTGAGCTGCTGTTGCGGACATTGACTACCCCTATTAAAGTATAGCAATCTCGTTTCGAGCCAAACGCTATTAGAGCGCTTAAGCAG
TTCAGAACGAAACGAAAATCTGATAAAAATCTGAGAAAATCTGATATTTTTTCGTCCTCTCGATTGCGTCTCGTTGTCTGAGAGAGAACGACAACTTTCG
TAAGAGCTTGTTGTGGCAAAACGGAATCAGAGGCGGAGCCAGTGTGAAATCTATAGTCTAGTCATAACGATGGACTCCAACAGCGACAGCGACAGCGACG
ATGATGTACTCGCTTACCGCCAGGCGGCGAAGGAGATGCTGGACACATCACGCGTGAAGAGACTACATGGAGACTGGAAGGCGGCATCCAGGCTGCGCCA
CAGCGCGTTGCTATTGCTATCGAAGGCTTCGCCACGATACTCTATACCCCGTGTCCGATTCGACATCAACAACGTCACGGACGACACCTGCCTGCTGTTC
TACCGCTTCACCCAACGCCATCTACGCCGTTTACAAGCTTCATTTCAGCTACCGAACGTCATTCGCACGGGCGCGAGCTCTCGTACGTGTTGTAGCGGTG
TAACGGGGTTACACGGACAAGTGGCTACAGTCACTTGTAACTCTAACAGATACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGTCCTTGGTGTAGACA
CACCAAAGGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCACCTCTTAGCCAATGAGCGAC
ATGCATAGCATTGGAATTCTGCCAACGAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTT
CTCATTTTAACCCAAAAACATTATTTAGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTAAACTAGGCTGCGCTT
CCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGGGCCAAGGTAGGCCCACTACACCTGGTAGCACTTTGTAGCCCGTCCAACGACCGACTACCTG
AACGTTCGAACGGAGCTGTACGAACGAGGAGCCGAGAACCTTTTCATGAGCGCGGAGGTGCCCATGGAAAGCTCCACTACGCCTGCAACTCACGTTGCAC
GCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGTACGCT
AACGCCGACAGAGCAACATGGTGTTGCTCTGGGTTTCATCCTGAAGGAACAACGCGATGTTGCTGCTACTACCGCGGTGTCATCCGGGACGACACCACGC
GCGCAATCGCTAAAGCTCAGTGTGAGTAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCCATTGCGGCTCGAC
GTATCGTCGACCCGTTGTCCAAGGTTGCGTTCGCCATTTCATGCCTTGGCGGACGAGCGAGAAGTTGGGCGTATGGACGCCGACTCTCTGATCCTACGTG
CTTTAGCACGTACGAGGGTTTCAAGGAGGAGCTCAGACAAGCATTTGAGCCCCCGCAAAATGAGTTCCGGTCGAGGGCGGAGTTCTTCGACCTGCACCAG
GGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGATGAGGCGACCAGGGTCGTCACGTTCA
TGAAGGGACTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTCCAATGCAGGAGGAGTTTAG
CCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGGACCCATGGACCTCTCGAGTGCTGCA
ACTGCTGGGCCCCAGCAGTCGCAGGGAAACAATGTGCGATGCTACCGTTGTGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGCCCCCGTGCACCAGC
AGGGTGGCTATCGCGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCTAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGT
GTCGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGAGCCAAGATGACAAGCCTGACCTTGTCATCCTGAATG
TGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCAAAGTCTATCAAGGCTTGACTTCGA
TGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGCGCTTCACGTATGAA
GGTCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGATGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGACATGATCCGGTCATCG
ATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCTGTTGGTGCGTGCGACTC
CCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACGCGCGCAAGAGCAGCTAGCGTCGGTGTTGCCGCCGACAGCT
AATGAAGGAAATGTATTGACCTCGGAGGTCGATACCCGCTTTTCAGCAAATCAGGAAGAGTCTCCGACCTCAAGGGGCACGGATGACGCAGGCGAGTCAC
ACGCCTCAGCCGTGGAGGCTGACGCGGATCTGATTGGATCAGGTCTGGCCAATAATAAGAGCCAAGGTGACGTAACGCCGTCGACTCCGGGAGTCGATGG
CTTGAGTGAATCTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGGGGTCTCCGCCAATGGTTGGCGTCGAGGTATTAAAGTCGCGACGGTT
CCGGGAACCGGCGCTGCGAAAAGGAATTTCGCGTCGATTCCGGGAGTCGACGCACCCCTTGTAATAAATGGCTCCGCCAATAACAGGCGTCGAGGTAAAG
ATGGCGTGTCGACTCCGGGAGTCGACGCTGCAAGCGGTGCGGACGGTTGCAAACGTCCCGCATCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCA
CGACGAAGCGCCGGGCGATCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCGGTACTGAAGAAGAACACCCGTCCACGGCTGGGCCT
GGACGAGGTCAAGAGTCCTGCGGAGCCGGGCTCCGCAGGACAAGAAGACAGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTAC
AAGAAATGTCTGCTGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGCTGAACGTCTTGACGCGTACCTGTGCCGGATTCCGGTACAGGGAGATGAC
TCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCATGATGGACGCATCGAGCAA
ATATGCATTCTCTCGGACGCCGAGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGACCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAA
GGAGCGCTTTGAAGAGCAGAGCTGGGGCTCGTTGAATACGAGTCCCTACTACGAGATATTACGGGAGTACGCGGACGTACTTCCGGAAGAGATTCCTGCG
GAGCTTCCGCAGGACAAGGGAATCCAGCACGAGATTGATCTCGTGCCGGGCACGACGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCA
AAGCGATCGGCGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACA
GGGCGGCTGGCGCATCGTTCATGCGTATAACAAGCTGAACGATGCGACGATACCGGCACAGACACCGATACCTCGAAAAGATGTTATCATCGATTCGATG
GCCAGGAGCACTATCTACAGTTCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATGTCCCTCTCACGGCAGTGAGCACGCCGA
GCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCTCTGCGACCTTCAACAGTGCGTGACACACTTGTTGCGCTCGGTGCGCGAC
TTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGAGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTG
CGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTC
CGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCA
AGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGA
TGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGA
TGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACA
AGGAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGTTGCGGAC
GGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAAT
GTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACACCATGCGATCGAGCACCCCGACGTCGTCAC
TGTTGGACGACGTGAAGGTCGCGGACGCGCACGACGCGGACGCGAAGATCTTGCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCGTCAGAAGTTGCC
GAAGCATCTTCGTGCTCGTGCACATCGTTATAGGGTGCACGACGGCTTATTACTCTACAGTGCAGTCGACGACAACGCGGAC