Description :
From Genome Similarity Track
Location :
contig_11:11577- 13495
Transcript NameFunction/comments
g2535.t1hypothetical protein

Sequence
1918 bases(100 bases per row)
CCGAGCGGATGAACCGGACGTTGGTGGAGTGTGCGCGCTGCATGCTGGAACATGCCGGCTTGCCCAAGACGTATTGGGGTGAAGCGGTGATGACGGCTAC
GTTCCTCCGTAATCGGTGTCCGACACGCGCCGTCAGCCACGACAAGTCTCCGCACCAAGTTTGGACGGGCAAGAAGCCGCTGCTGGCGAACCTGAAAGTG
TTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCGGTCGGTGCGCTGTCGGTTCCTGGGGTACTCGGAGCACGAGA
AAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAGTTCATGGAAGACGTCTTCGACAGTGGGAGACGCGACTACCA
TCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGTCGGATGAAGACGACAACGAAGAAGAGGAAGGGAAGCTGCGC
GGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCGCTGGAGGAAGTCACGGAGGTTCCAAGTGCCAAGCGGTATGCGTCGCAGAG
TCGACACCAGACTCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCTGCGTACGTCGTGGATTCAGTGGGAGAAATGCCGACCACG
TTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTCGGAGTGTGACTCGCTGCTCAAGAACGACACGTGGGATGTCGTAC
CACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGAGAGATTGAGCGGTTCAAGGCGCGACTGGTGGC
CAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCAAGTTCACGTCCATCCGGATCGTACTGAGTCTGGCTGCCAAG
TATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGACGAAGACATCTACATGGCACAGCCGGATGGCTATGTGGACG
AAGACCACCCGGACCACGTATGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAGTCGCCGCGCATGTGGAACCAGACCATCGACGACTTCATGCTCAA
GCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCGTCTACCTGAAGCGTGACGGCCAAGACATGATCTTCGTGGCGCTCTACGTTGACGACTTGGTCCTC
GCTAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGGTTTGAGATGACGGACCTCGGCGAGCTGGAGTACTTCCTCGGGATGG
AGATCAAGAACGACCGCGACTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTGT
GAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCTGCCAGCATGAAGACACGATGAAGAACGTGCCGTATCGGAGTGCC
GTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGCTGCTGCAGTGGGGAGTGCTGAGCCAGTTCTCTGCCGACCCGTGTCCGACGCAT
TGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGCTATTCGG
ATGCGGACTGGGCCGGCGACATCGAGTCAAGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGA
CGGTGGCGCTGTCTTCAA