Description :
From Genome Similarity Track
Location :
Scaffold_1:11576- 12960
Transcript NameFunction/comments
Albla_Nc14000080

Sequence
1384 bases(100 bases per row)
TTATACGACTTCAAGTTACTAAGAGGTGAAGATATCATGGACCATATTCAAAAGTTCCATGAATTGTGCTTGTCGATGGAAGCATTGGGCGATGTCATAA
GCCAGGATGAAAAATTGGTATCTTTGCTCGGAAGTTTATCAGACGAATATGATCGAATCACAAAATCATCGAAAATATTCAGGGAATCGATATTCTTCAA
GTCAAAGAAATGCTTCGAAGAGAGTACGAAGGCATGGTGAAGAAAGAAGTCAGCGAAGTTGCATTACAAACAGCGAAGTACAAATCCAAGGAACCCTACC
AAGGATGGAAAGGAAGGTAAGAATGCAAGAAAAAGTCAAATATAAAGTGCTTTCACTGTAACCGAAATGTCCACATGAAAAAAGACTGCTGGAAGCTTCG
GAACGGCGGTAAGGAAACAATGAATGAGCAGGCGTTTCAAGCTACGAGTCAAATGCATGTGGCTGGATTCTGGATAGTGGCACCAGTAGTCACATGTCAT
TCAAGCACGATGATTTCACTAATCTTGAAGCGATCACGACATCTATCAATATTTCAGTTGCGAATGGGGCAAAATTAGAAGTGGTTGGAATAGGCTTAGT
TCACATGAAGCTTTCGAATGGCAGACATATCAGAGTTGAAAATGTGCTGTACGATCTTGATCTGGACAAACGTCCGTATCTATATCATCAATAAATGAGA
AGGGCTTGAAAGTCGTGTTTGGAAGGGAAACATGTGAAAATAAGAATGGGGATGAACACATCATTACACTTCCCCGATCAGGAAGACTATTTATCATCAA
CGCGCAGATCAACGAACATGTTTTATTGGGATAGAACAGGAAGATAAAGGTGGTAATACACAAACATGGCATGACAGGCTTGGACATCGTTCGGAATTAC
AATTAGCTCAGCTGGGGCGAAGCGTAAAGGGATACGACTTGGACAGAAAAGTGGAAGACTGCATGGAGATACAGGTCTCCCTTGGTTAATGAAATAGCAA
ATACGCATTACGTTTTGAAGGTTATTAACTGGCACGAATATTAAGGCAAAAATAGAACATTCCCAATGTTTTGAATGAGATCTTACAGGTCGTCTGGTAT
AATGCCGGTTTGGTTCCAGCAATTCACCATCATGGACTAAGTCACAGCTTTCCACGCATCACGGCACCAATGCGTAGCCTGCAGGACGTCGACTCTGCAG
ATTTCCTCGGCGCACTTCTCTTCGTCGTCAATGACACTGTCTGCCACGTTGACAGCATGACATCCATGCATGCGGCGGCAGCACGCCTTGAGACACGAGA
TGACAGCCGCGTTCCTTGGCTGCAGGATCAATGTGGTGTTTTACGGTAGTATCTTGATCTCTACGTTTCTGATAACCGTCTAGA