Description :
From Genome Similarity Track
Location :
Scaffold_1174:11574- 12993
Sequence
1419 bases(100 bases per row)
gcgacTCCCGTAAAGCCGCACTCCAACTCAGACCGAATCAGAGAGTTTGTTTCAACGAACCAAAGACCGAGAAAACGAACCAGTTCCTCGTTTAAGTTCA
GGTTCATTCAGGTTCGGTTCAACTAAGTTAACCCCGTTTGGAACCTATAAAACCTTAGAGCCGTGGTTCTGGGGGGTTTCAGGTTCACTTGTTTTATCGT
GAACGGCGGTTCAGGCTCGGTTCGTTCTGGCCGTGACTGTCGTGACAACTTTAAACCAATCCAACTTCCTTCAAAGACAAAACTGAGCTAAAACTCCGTC
TGACTATAGGGCGTTTCACTCTCGGATGCAGCATACACATGGCTCGAATGAAGGAATAAGGAACAGCTATTCCCTCTGTAACGGGCGAACAATTTAACCT
TGTGAACACGTGTTCGCAAGGTTTTGGACTTCCATTACCCATTAACTTAAACAGGAGGAACACAATAATCACTTAGTCGGGTGGTGCGTACTTATATTTC
ATTTTCCAGCGCACTGGTTGGCTGCTCGAGGCAGCGAGAAACGCTGCACAAGTTCGCTTTAAGTGCGCGGCTTTCCTGGAGAGTCGTGCCTAAGTTCGCG
GGGCTTTCCTTTCAGCGCCTGTTGGTGCCTTCTCAGGATCGCGGCTTTTACTGAGTGAACGAAGGTTTCTTGTTAAAGCCAATGAGAACGACAGAATACG
AAGCTGTGCAGTTATTCTACAGTTACAATTCCTTGTTTTGGAAGGTTTTTGGAAGGAACAGAGACTATCGGTATACCGTGTTCGTACGTTACGAAAACTG
AGAGAAGAAGCGGATAAACCGGTTTATCCGCCTTCATCCCTCCGTCTTCATTCGAGCCATGAGCATACATGTAGTTacgccagctccatgtcCCCGTTTG
CAGTCGGAAGTACACTTCTCGTGTAACAGGAGGCACTGCAAACGAAAAGATCGTGGAAAGGACGTTCTGATTTAGCTCTTACACTTCGCGGTCGTGTGCA
GAGATCGGGAATTCTTAcctctcttcttcttcatttCCTTGTTTCCGGTCGTTAGTCAATTGGTCAAAGGACACCTCGCGCAGGAACGCGAGTCTGTTTT
CCCATAGAGAATGGTTCGAGTACGCAACTAATCGGCTGCAGATGATGCTTCCTGAAGGCATCTGAAGATACGTTGGAGCACGATAACATCGAGATACTCC
AGCGTTTGGTTGACGTTTAACATCGCTAGAAGGTCCTTCGAGCGCGGCTCCGCggctcgccttcttcatTTCTTCATCTGAGTACGCCCAAACACTTGTT
AGCCCCTTCTTTAGGGTCGATTTGTTCCTTTcagagcatctccagcggtaGGTCTCAAAGGCGGTTTTATCCCAAAAGTGGCAAGATGGAGACTCGATCG
AGTTTTAAGGCTTCCAGCG