Description :
From Genome Similarity Track
Location :
Scaffold_27:11573- 63266
Transcript NameFunction/comments
Phyta_totarag1439hypothetical protein
Phyta_totarag1440hypothetical protein PHYSODRAFT_533148
Phyta_totarag1441conserved hypothetical protein
Phyta_totarag1442hypothetical protein PHYSODRAFT_532690
Phyta_totarag1443hypothetical protein
Phyta_totarag1444hypothetical protein
Phyta_totarag1445hypothetical protein PHYSODRAFT_353200
Phyta_totarag1446hypothetical protein
Phyta_totarag1447hypothetical protein PHYSODRAFT_356191
Phyta_totarag1448folate-Biopterin Transporter (FBT) family
Phyta_totarag1449hypothetical protein PHYSODRAFT_566444
Phyta_totarag1450hypothetical protein PHYSODRAFT_362528
Phyta_totarag1451conserved hypothetical protein
Phyta_totarag1452conserved hypothetical protein

Sequence
51693 bases(100 bases per row)
TCAACTCACATTTAACATCGCGGTAAGTTGCAGGCTGCCACCCTGAGTCGATCGAGGAATCCACAAAAGCAGCGAACCACCTCCAGTGCCGGGAAGTTCC
AAAAATCCCGGACGCCATCGATCCAAATACAGCGTTTTTCCTCCCAATGTTGTCACGTTCGACTTCCAAGTTGCGGTTTGACCAGCTGGGACAGCCACTt
cgtcgatcttgtcgcCACCAGACTTGATGTTCACGGTCACATCTTCGGTATCAACGCTCTTGAATGTAATGGTGATGGTGCCGTCGCCAATCTTAGTCCA
CATGCCGTCACTGTTGTTAAAAGCACCTTGGACAATCGACATGCCCAGTGCTTCTTTCACATTGCCATCATCGATCTCCCCGATGAGTTCTGGACGACTG
CAAAGGGGCTCAAAGAACTCGGAAACAACAGTAGAAACGTACATTGGGTCCCAAATGGCccagacagcaacagctctATCGGCAATTTTTACTGCGTATT
CACCAGCAGAGAGAAACGTGCCGTTGTTGCTCGTTCCCGACTTGATTAGGTCGTCTACGATGACTCCAAAAGTCTTGCGCAGAGTATCACGTATGGCGTA
TGCTGTCGTTTCATCCGCTTCTGCGACCAGATCGCCCATACAATTATTTGTTGCGATAGGGATATCGTTGAGTACGAGGTTCGACTGACTCATGACCACT
CGAATGTCGTCCTCAGACATTTCCGGGTTCTGGCTACGAAATTCAGCCACAGTCATCCACGTGCGATCCAACAGACGCTTCATGTCGTAGCCACAGGTGG
AATTGGACTTCAGCGCGGACTTCAAAGACTTGATATCTGACTTTTTCAATGAAGAAATCGAATCGCCCAGAGCGATGTTTTTCATGAAAATCGTGAATGC
GGTCCAACTCGAAACGATGCTGGTGCCATGGTATATAATTTCTCTCAAAGCGTACTCTGCAGTCATAAGTACACTGTCAGCGAACTTGACATTATCGGAC
GCTTTCTTCCCTATGCAGTAGGAAATAGCCACAGGTATGTCGATGATGACGTTGTCAATCTGGTACAGCATGGTGAGGATCTTATCTTGTGTTGCTTCTG
GATTGTAAACCTTGATGTAGCGGATATACTTGACCAGCGACTTGGAGAGACTGATCATGTACTTGGTACATTTGATAGTGAGTTGAATACTCTTTGCCCA
CTTCGTCATGTCACCGTAAACACTCCATGCGGAGAGGGAAAGTGCCGTCTGGACCACAACTGCAACCTTAGACACGATTGCAAGTCCACAGTCATCATTC
TGTCGGATACACTCGAGTCCACACTCGACAGGATACGAATAAGGACACTGTGTCCAACACATTCCGAGCATCCTGTCGAATCCCAGAGGACACGTCTTCG
CGATGTGAGCTCTGCGCCAGCACgcggaggaagatgaagtgtCGAGTGCGGTACCAACCCAGTTGGTGTAGGTGGGTTCGATCGTGCTAGTCGCGTTCAG
CACGCTGCCGAGCTTAAATGCAGCTTTCATCACTGCCAGTGCCGCCACAGCCTCGGATTCATCTGTATCATCGTCACTGCTAGTAGAAtcatcatcgctg
ctgtcttcggagtcgtcgctgtctcGCTCGGATGTGTCGTCACCATTACCGGACAAGTTGTAGGTCGATCGAACACTTCCCGTTAGATTTCCATCACTAC
CGTTTTCTTCGCTTGACGAGTTGAAGAGAGGCCTGCCAGGATCCGAAGAGTGGCTTAAATGACCAACAGGGACCATTGACGTTGCCCCTGTGCCAATGGT
GTAAATTCTCGCCAACGGCATCCCACTGAGCGTCGCCGCACAaacagcgagcagcaccgcGACCCGCGTCACCTTGAGTGAAGACATCGACTAAATGAGG
GCTTGGTAGAATGAGAAATGAGGAGGCTCAACTACTGAAGCATTGGGGCCGAGCGTCTTCGATTGACGCCTTGTACCCTGCGAGTGTTTCTCTGTTTAAC
GAGCGCCATCTTCCGCAAAGCCGCTGCGAGTGAGTCATTTGAACGTGCCGCCAGACACTGCTTCCAATCACCAGTATTATTTCCGTCTGTCTATCTGGTT
GTCGAGCACTGCGCAAGACTTGGCGCTGTGAAGGGTGCGAGTATCCTGCGCCAGTCACTTGGCTCACTTACGGCAAGttgccaagctgctgcacccTACA
ACCCCGTGACGTATTGACCATCGGGATGCGAACAGGGATTAGCACGTCAGAGTGGTGTTGCTCAATTGAGCAAACACGCAGATTCGACCGCCACCAGTCG
TTCGGACTGCAACAGGTCACTCGGTATCAAGAAAAGCGTTTAAGATTTGCATCAAAAAGATactgtaagcttacagtTGAAGCTACTCACTGCAATACCA
CGGTCATGCACCGTTAAGCTTGTGGCCTCACCACTCCTGCCTTTGGCTGTCAAGGTCAAGGGTGATTCGCCATCGAAAAGGACCGAAAAATGCTAAATTG
CTGATAGCAATTAGTTATGTCATGCACACCTCATTATGTGGTGTACATACAAAATGAATGGTAAGAAATAACCTCGGAATTAAAACTACTAGGGTTAGAG
TTAGAAATGACCTAATTCTGAGGTTTTGTCTACCACATCAGCTGCCACACATATTCGCTGCACTGAGGAAGCTCGCGATCGTCATGGTGCAGGTCTTGCT
GGTCGCTCTCCGCGCCGCGGGGCGACacgccactgccgccagGTTCCTGGCCACTCGCAGCGCTTTACGACACGCTGCCTTCGCCACGCAGTCCAGTGGT
GCATCTCTCACTGTGGAGGACCCATTTATTTATCTGATCATAACCCTTTCTAACTCTTATTTGCTGTTATTTAATTTAGTGTACACATGGGGCAATGGCA
CTCTGGGCCAATTGGGTCACGGGCCTGTGGTCAAGTCTGGCATCCGCAACGCGTATGAGGAGCTGTcgcccaagctgctggaggcgttCGAGGGCAAGGG
CATCACCTACTTGGAGTTCGGCGCCAGCCACAGCGCTGCCAGTACGTCAATCATCAATGGGATTCTTTAATTTTATACGTTTGATGCAAGACAGAAATAC
TAATGAATTGACCTAATTTTGTGTCTTTGTGTAGTTGATGCGGACGGCAAGTTGTTCATGTGGGGCTCCAACGAGTATAGCAAGTTGGGACTGGGAGAAA
GcagcgagatggagacgctccCGAGAGAGGTAGAAGCTCTCCAGGGCATCAAAATTGTGGACGTGTCCTGTGGAGACTATTTCACGGCTGCGGTGGATGC
GGACGGCAAAATGTACTCGTGGGGCTGGGGAGGCTCCACGATGAAGGGCGCGGGCGGTCTCGGCCACGCTGGCGGCAAGGACGAGGCCACACCGCGtctg
ctggcgacgctggtggaCCAGGGAGTGCCCATCTCCACGGTGGAGTGCGGGGAATTCCACACGGTGGCGCTCACCACGGACGGCGAGATCTGGGCCTGGG
GCAACGGCGAGTACGGACGTCTGGGCAACGGCGAGTCGGACACGTGCGAGGTGCCGGAGCCTATCGAGTTCTTCTCTAAGGACAATGTGGTTTCTatcgc
tgctggtcgagacTTCTCCTTCGCGCTGACGGACAAGGGCGAACTGTACAGTTGGGGAGGCAACAGCCGTACGTTGACATGTTTGTTGTATTTGGGAGTA
TTTGGATGATGCTCATTTATTTATTTGTTGTGGTGCTGACTGTTACTACAGAGAACCAGCTGGGTATTGGCGGTGGGCTAGCTATGGATGTGTACAACAT
CGAGTCTATCCCGGTGCTGGTTGAGGCGTTCAACGGACTGTCAGTAAAGCAGATTGCAGCTGGCTATGACCACGCCGCCGCGGTGACGGAGGACGGACGG
CTGTACATGTGGGGCGCTAAGATCTGGATCGAGCCTCATGAGATGACGGCTGTGAACGAGCACCAGGTGGTGCAGGTGGCTTGCGGACGACAATACACGG
TGGCATTGACGGACGACGGCAGAGTCTTTACGTTCGGCAAGGGTAGCTCCAATTGCCTGGGCCACGGCGACCGCAAgaaccagctgcagcctgTGCAGAT
CGAGGCTCTGGCCGACATTAACGTCACCTCGTACGTACATGTGTTGCGATGTTAGATTGGTTGTAGAGGCTAACTCGTTCGCTTTAACTATTCAGGGTAT
CGTGCGGCGACTACCACATGGGCGCCATCGCGACACCCCACGCCGAGGCCGCGGACAAAGACTTTTCCTTCCGGGAGTAGGAGACACGACTTCCAAGCCA
AGTGGTAGCACGAACGTAAGCAATAATGGACCAAATTGCTCGCGCTCCTCCAGATTACTTCAacctgcttcaacttgtttACCCAGCCTGGCCCACCTGC
AAATGTAAGCTATGTCGATGAACCGTCGTCTCCGATCTTCGGCCATTAATTGTGCATTTTTGCATCCGATCAAGAGTTCCGTCACTGATGATTCGcgtgg
tgttgctggtgtgCGTGGCAATGACGCCGtgggtgctgctgttctccgGGTCATCCCTGTATTCGCTCGTACGCACCGACAATTCGCCGAATTCGAGTCA
AAGAAGAGATATCCCGCTAGAAACTGTGTCCATGCTGAATGGAGCGAACAAATTTGAGTGGCGACTACTACTGCGATGGTGGAATGGAAGACGAGAACTC
GCCCTCACGCTGGACACGTGGCCCGAGACGGACATCAACATGGACGAGTGTCTGACACGTTACCGAGACGCCAAACACAACGAGGTCTGCGTCATCAGCA
GCTAGGATGAGAGACACAAGAAAGACGGCTGACATCAAGTCCATGAAACAGTGAAAAATCTATCGTTCTACAGGCTTTGCTTGGTCGTTTACTTGCCATC
GCGCTTACGTTTGAGGTTGTTGCGACTGTGCATGGCAGCGGAACCGGTGCCGTCCGATGATACGACGTCGGTGACAACGTACGGAGCTTGAGCAGGCTCG
TGTGCAGATAGCATGATGCTGTCGAGCGGCATACTGCTGCGTACGAGCAAATTGACACGTTGCAACACCGAGAGAGGCAGCGGACTCAGGATGAACACTT
GGCGTTTCTCGGCGTCCAGCGCGCGAATGATCCCAACGCCTAGACACGGAGCATGCACAGGCTGGAGCACGATGCGTGGTGATCCCTCACGCGGCTCGGA
TATGTCGTGCTCGAACGGTTTGTAGTCGGGGTTGATGCAGAGACCCACGACGCAGGCGTTGAGTGAGAACAGGAGCTGGCTTGGAGGCACCGAGGAGCCG
GCGAAAGCAATATCGACCTGGTCAAATGATACGGCGAAGGGCGCGAGTTGGGCATACGCGCGGTAGATGTCGCTGTCCACGCGGTTCTTTTCTGATAGCA
CTTGCAGGTTCTGCAGCGATGGCCGCGGGAGGTAACAACGGGTACGAGCCAGGAAGTACGAGTGGGAACGGTAGACTCGCAGTTCCTTGGAGCTACGTGG
AGGTTGCGTCACGCCCACGGGGTCCCAAGGCGGGACAGCGTGAAGGCGCCACCTGCCTTCTGTGGGGACATCAAACTGCTTGTTTTTCGTcgcagccagc
agctgcacgacatGGTCGGGGTTTGTCTCCTGAATGACGTTGCACAGCAGGTCATGGCCCATGCTCTTAATCCACCCGTCCGTATTAATCACCAACGGCA
CGCATCTTGTCCGAGGGCTTGCGTTGTCGTTGCTCGCAGTCCTTTGAACTCCCCATTTGGCTTCGTACAGACGCAGTAAACTCGTGACTGCCTCCATGTA
GTACAACGGATCGTTGCCTGGGTTGGCGTTGCCACAGAAAAATGACCGGATTGGGTTCTTCATGTGCGAGAAGCCCGgacccagcagcggcgtcgtcAAG
GCGTGAAGCGCCACAAGGCCAGACGGCGTGAGTTCACTCTGGCCCAGGTCTGTATCCAGGAAAGCCACAGTGTCAAACTGCGCGAGTAACCGATTCACCA
GATACCTGCAGAATGTGGACTTGCCCACGCCCTTGCCACCACATACGATGATCTTCTGCGGTGTCGAGTTCTCTCCCGACAGCAGTCTCGCCTGCAGTCT
GTCCACAGTCGCCTGCCAGGGCTCCGTAATAtgcagcgtcttgaacgaatccaccaccaccagctccgccagcacaCGCTCCGGCGACTTCCAGTCATGA
TGCATTAGATCTGTGGTCGGGGGTGCAGCACTCGTAAAGTCGAAGCCTGCAGTAAGGTCGCTCAGCAAGGTCTGGCTGTGTTTCGAGACAATCATCTTGA
AACCAGGCAACACCGCCGATGGTTTCTCCGGTCTTGTGTTCTCATAGAAACTTGTGACGTTCCCGTACGTGACGGGGATGGCTcgaagcaccagcacaat
GGGGAATTCGCCCACGAGCTGCATGGCCAGTCGATCCGCcgcgatctcctcgtcctcgttcacAGCATCCGACGGTAGATTGGGCTCCATAGCTTGCAAT
AGACTGGCATTAGTAGGTCCGAACGGTGCTTGGGTCTCTTCATTGCCCGGCCGGCCTTCGATCACTAGCAGATTGTTCCATTTGGGCGAGTGCAGCGAGA
AGTAGACACCCAGAGGCGGTCGGAAGCCCAACACCTCCACGTTCCCCTGGACAAGCCGGAAAAGCGTCATCCCGGCGCAATTCACAGACGCAGACTTCTG
CATCCCCAGTGCGACCACATTGCCAGAACGCACACATAACGCGCGGTACAACGgcgaagacgccgccgcgcCAGCCGCAGGACCGTAATGGGCGATGTCC
GCCATCGATTGTGATACCAGTACAACGATTGACCACCAGCGATTTGAGGTTTTCTCACACGTCGCATGTTCTTCAAATGAGGTAATTAATTCTCACACGT
CACACATTGcagtcaacttcaacacgaagGCCTTCCGCCTATTCTCGGTCCTCATTTAAGCGATGTCTATAATAAATGGAGATGGCACGAGCTGGAGTTA
TTTCCGTGAAGAGAGTCTAAAGATAACAGACGACGGCCTGGAGTCCCAGTCCTAGTGTTACCCtctgtgcttgctgctggtcctgCTACACGAACAACGT
GTGCGCGTCGGCGGGAGCATGTTACCGGCTCTCACCACCAAGCCGAAGCAGGCGGTGCGTCAAGTTAAAGGCTTGACGAATGACTCCATCGACTCGTACT
CGAACATGCCGCTAGGCGGTGGCTCAGGGATCGGCAGTGgagtggcgacgacgagctaTGTGGATAATACCGAGTCAGGCAGCGGGACAGCGCGTgcgtc
gccaccagcttcaaGCCGAGCGAGTATCAACACTGGACGTGCTACTGTTACGAAGCCTTCGACTGGCGATGACGGAGTGGCGATGGCTCGTGTAGTGCGA
GACCGCAAGGCTTCCGGTGAGGAAGAGTTGTCGCTACGTACGGGAGACATCGTGAAGGTGCTTTCCACCAAGCGCACAGGGTACCTCAAGTGCGAAGCAG
GAGACGAGATCGGCTACGTCCCGTCCTCGTACTTGGAATTCctcgacggcgctgcagaagccgATAATggcagcactgaagaagctcagcgtGCAGCTGA
GAAacagcgcaagaagcagcaaaagaaggagaagcggaagaaggagaagcgcgaGACGAACGATGCCAGTgaacctgaagaagcagctcctgctACTGTA
CGCTCGCCTCGCAAAGAAGCTGGCaacgctgaagacgaaggcaaCGAGTCACCAcgcaagaggaagaaaaagGATCGAAAACATCGTCAGGATCGTGAAG
CAGGCGAAGACACACATCGAGGCGGAGTTTCTGGTGTTGAGGAACCGCCAAGCACTGCCAGGTCTCGAACTGCACTTGAAGACACGGAGCGATCTCGTAG
TAAAAGTAAACATTCCAAGAAAAAGCGTCATCGCGGTGTAGATAGCAGTGAATCGAATGAGAGTGACGGAGGCAAACGTAGTGGTCGTCAcggtcgccgt
cgtcgtcatcgacgtggGTCAAGTGCTAGTGATTCCGGTTCAACGTCTTCCGACGATTCGGACGGGAGCTAcagacggagacgacgtcgtcgtcgtcaca
gacatcgaagaagttctagtgaagaagaagaagacgaagacaacgacTACAAACGACGCCCAAGACATAGCAAAAAGCGTCGCGACAAAGGAGACGGCGA
TTCTGAACCTGAAGAAGGGTCTCGTTCGGCTCGTaaggccgagaagaagaaggtggctgCAACTTTACAAGAAGTGGAGAAAGGAGTGAGTCAGATAGAT
GTCAAGGCCGATGAGAAAACATccgagtcgaagacgacgactAACGTTACCTCGTCAagcaagaaggaggagcccAACCGGGACAgagagaagaaagagg
agactGAGCGAAGCGAAGGTGCATCTGAAGGTCGAGCAACCAGTGTTTCTACCAGTCGGAAGGACGATGAAGGTCGTACCAGTTCCGGCACCTCGTCCTC
AAGCAAGCACAACGGTAATAAGTCGGGTCTCGGCAGGCAAATTGGGGAGAAGATGCGCTCATTCTTGGGTGgaagcaagaagcagcagagtACCAAGAGT
TCGAGCGGCATCCTGAACGCGTGTCCAGGCACCGTGCAAGGCGAGGAAGGTTGGTACGAGCACGGCGAGAATGAACGCTACTATTTCGTGCTTGTAGATG
GTAAATGGAGCCTTCTGTACGGTCCCATGACTGAGGACGACTTCGAAACCTTTTCCAACCGGGTACGTACATGGTCTCGATGCTCTTGCAAACTTACCAC
AACTCTGTTCTAATATTTGAGTTTCGTTTTGCTAACCTGCAGGTGTCGGAGCTAAATCGTACCATCGAGCTGCCTCCGACGTATCTACACAAGTCAGGCT
ACTATCTCAATCAGGAGCTGCGTGTGCTGAGGGAGCAGTGAAAGCGTAAGCAACTACCAGCTTCATTCCAATATATCATGAGAACGAAAGTACCAGTAAG
CATATGCATTATTCATTTCTTCCTTATGAAGTGTTGGCCGGCACAGCTATCGCCCACCCGAtcttttttttcttcttgttaCTTCGTTGGTCCGGTCAGC
GACTCGCCGAGAGTTTCCAGGACAACTTCCTTTGGGAAGTAGAGCTCTGGTCGAATGGATTCCTCTTGAGAACCTGCTCCCGTAATCCACTTTGTTGGAG
ATCGCAacaactccttcagctcctcaCTTAGCGATAGCTTCCGCCGTGGAGAAATCGGTGGAGATGTGGGATTGAGctcgatcttcatcttcagcttgtc
gGTCTTGTTTCTGCTGGTTACAGGCGCTGACAGTGTCGCAttcgcagcaacagcgttCTTGACAAGCATCCAGCTTGTCTGCTTCTCATGTGGTGACAAT
GGCTGCACCAGTCGCTTGGAAGGGGACAACTCCTTCCACGTTGAACTGTCCACTGCTTGAGtggcagcatcgtcgtccgTATTCAGATCTAAGTGCAGAC
TGGACGGCTCCTTACGCTGTCCAAGTCGCACTTCGTTCAGTTTTCGATCCACAAAAGTCGCCTGCAACTCAGGGGCTACTCGCTGTGCAGAAGCCGCCAC
CTTGTCTTCACTCAACTCCTCTGAACCCGCCTTGCCTTCTGTATGATACTGCATTTTCCCAAGAATTTCTGGCGTGCGGGTAATGCTGAAAGTGCCTTCC
CGGTGCATCTTCACGAGCTCTGCCaaatgctgttgctgaggCAGCCAGTAAGTTGCAACGGTGTGATAAGCTTCGCGGTGACGTTCGCTGAGTCCATTGG
GCACTATGCACACCTGTTCCAGCttatgcagcagcactggcgtCTCTTCTGAGTGCAACTTCCGGTTGTTCATGCAGCGTTCCGCCTGAGTTACGAGTCT
CTCAAGCAACTCGAGATTCGACTGGTACCGTTCCTCAAGCTTGGTTTGCGCCTCCTGCTCTCGATCCCGCAATCTCGAGCACTTGTCACGCACCTCCCGG
AGTAGTTTTTCCGTCTTCACCATGTCCATTTTGTTACCAGCTTCAAAGAGTAGCAGGCGGTCAAGCAGCACTTTGACTccgacaccttctccatAAGCGT
GATCGCACCATCCAAGCCCGCGCTGCAGCCACCGGCTACGTAACGTGAAAGCTGCAGATGCCCACTCCAGTCTTTGGCGATGAGCAGTACTAAGCTTCCG
CTTAATACTCAATTCAGATGCATCAAATCCTAGCAACCAGTCTGCAATTGACTGACTGATTGACCATCGCCGTCGTTGTTTCGGAATACTAACACCATCC
AGGCTGCTACACTCGTCGAACGGGAAAGTGTCTTGCAACCGATTCGTTGCAAGGTCTACACGCGAGCGAAAGCTCGTAACCTCTTGGAACACGTTAGCGG
CGTAACTGATGGCCGCGTAGTGTGCCATGGCAGATGCATTGTTGCCATCTGGGCACCGCGCGAACATTTCATCACTCGGTGTGCGAATACGCCCTGCGCG
TACTGCATCTTCCATCTCCTTCCTCGTAAACGCTTCAGCTGGCAACCTATAGCTCGCACCGACAGTTCTCTTGTTGACGTTATGCAGTTCCATGGCAATT
TCTTCCTTCGTCACAGCCTCGTCCCGAGACTTACCAAGGAGAGCCCGCGTGCAGCGATCCAGTGCCGCGTACTTGGCCAGCCGTCGAGTGTATTCCTCGT
GCACTAGCAAATGCTGGAATCGCTCCACAAGCGTCAAATAGTCACCACTCACGTCAACCTCAGAAttttcaacagcagcagcgaacaTATCGGCTTCAGT
TCTCTCGTTTTCATAGTCGAGCACGTGCGATTCACCGGCGAACGTGCGAACCAGAGAATTTCGCTTGCGCAGTGCCTCAAAAAGAAACGTCTTGCGAAGT
ACTTCAATTTGCGTGTCGAAAATGCCCAGCCCTGTGTTTAGTGCctttgaagatgaagtcgGATTACTACTGACACCTGTGGACTGTGTTCCTATGCGGA
CCCCACGCAGAATCACAGGATCACCCTTCCGGTCCATTCCTCGTTCCTGGAGTAGCGTCTGGATAGCGTTTGTGTCCTGCGGCAAAGTGACTTCTTTGAT
TTGATGACGGTGCATCAGTTGAAGCAATGTCGTGGGGTTAGCCGTGGTCGGGACTGTGATGCCCTTTTCAACTAGCACCTCCTTCTGCATCGTAAATGCC
AGTGACTTCACCAGATTCTCAACTTCGGTCGTTAGAATCTGCCTCATTGTCATCTCCCTTAGCAGCGGCTGGTAATTTTCAGGCACCGCCAGCTCGCGAT
TCTTGCTCACAGCATGATCGACATTCCAAAGTAAATCAGTTTTACCGAGACTCTTCATCGCTTCGTAGAGTTCGGCCACGCGCTCCGGATTTGGTAGTGA
GAACGCTTGTTGATTGTCATCACGGCGTTTTTCAAGTATTTCCTCGAGTTTCTGTATCTCTTCGTGCACTTCTTTCGGCAGTACTACCGATTGGGAGCCG
GACTTTGGATCCGCTAAAGACGGTGAGACCCATGCGTCGTCTCTAGCGCTAAACTTTTCCTTCGCAGCACAAGTCGGGTCGAATTTTGAAGTCTTCGGAA
TCACGCCTCGGTCTTCCAGCGCGAGACGAACATTAGCGGGATTATAGACCATCTCTTCTTGAGTGATCATCAAGCGTATGTCCTTCCCATCACGTGAGTA
TGACAACCAGTTTTTCTTCTCTGCGTCCATCGTAATGCGGTGATAAGGAATGCGCTCCAGTTCGTACTTGGCCTCCTCAATGGCGTACCATTCTGCCATA
CCCTCCAATTGTCCATTGTCTTCAATGCCACTCTCAGACCGGAAGCTACCGCCAGATAACACACGGCTGCTAGAACCTTGATGGTACAGCCCATGTGGTC
TGCTACCTGTTCCGCCTTTACTTTTCGGTGATGGTGGCGCTATCCCACTAGGACTGAATACCTTTTCAGGCCTGTTCAATTCTTCTTGCCGTCTTGTACG
TGTGGGCTTCCACAAGTGCATTTTTTCTAGGATAAATGGGGTATGTTCACAGTCGATTGAGTGCTGCGTTTGCATTTCCACAACCTCATGTAGCCATTCT
TGAACCTGTTCCCATCGATTCTGTACAGTGTCAAGCGCTCTAGCATCCACATCCGCAAACCCCTCGCACTGCtcatcgagaagcagcagcaattcgTGGG
TGCGCCGCCAATGCAAACCCTTTTTCTCCATCAGCCGCAACTCGCTCAGAGGGCCATTCGGCTGCGTGATAGCCATCCAACGAGACTGGATATTCGAGAC
TGCGTCGCCATGGCGAATATTGAGTCCTTTGCTGCAACGCTGCTCCACAATATTTAGAAGCTGTGGTGCACGAGTCAGGTTCAGCTTGCCTTCCTGCATC
GTCGCGAGCTCCTCCAAAGTATCCAGTAAGATCTGCCACTTTtgcttcacttgctgccaCGCTGTACTCAATCCAACGTCGAGGCCCTCAATTTCTTTCT
CGATATCGTCAAGCAGTGCAGGCGTGCGTTGCGCGTGAATCCGCGTGGTAGCCTGAATGGTTAGGAGCTCATCAAGCTTCGGCTGCAGATTAACCCAACG
TTTGTGTACTTTCATCACAGCCCCCCGATAATCATCAGCCATTGTTGCAATGCTCTGCGTGTATTCTTGCTCTTCCGCATTAGCAttcttctttttgctg
tGGGTTGGTGAGCTCTCCTGCAAGACGAAAATATCCCAAACAAGGCTAAGTAGCACTGGCGTACGCTCCCAGTGTAGCTTGCCCTTGGTCTGCATCGTGA
GCTCGTCCAAATAGCCTTTGAAGGTCGCCCAGCGTCGACGCTGGGCCGGAACTACCGTGTCATGGATACGCCGGCGAGCAATTTCGTGCTGGTCAAGATA
CTTTGCTTTCCAGACCTTGTACACGTTTATCGCTTGTTCCAGGAATGAACTCTCCGAAAGTTTCAGAAAGAGGCGCAAACGCACTTTACCTCTGTCATTC
GCTCCAGGCGTCTGTGTAGCAGTTTTGAAACCTCGCAAATTGGTAGTAGGCAAGAAGAGAAGTTGGTACGTGTCATCATGCGGCTGCTGGTCGAGAAGAT
CCATCAGCGGTATGCAAGCAGTGCCCAAATACCCGTCAACATTATTGCGGTCTTCATCCATCACCTTGACGCGCAGTGTTGCTCTCATTATCATGTCAAG
TACGCGAGACATTTTTGCGAGTCGAAGCCGCTGGTAGAGTCGCTGACGAACCTTTTGGTCTTCAAACTCCAATTCTTCAACCTCATTATCAAAGAATGCC
AGCAATTTTTCACCTTTAGCGATATCAATGCGGTCATCATCAGCGTCCAGCGTATACATCTCGTTCAACTTTGGCATGAAGTGTTTGATGAACATCTCGT
GCAGTCTTAGAACAGTGTGACGAACCCGATGAGTGCACGTTGCTACATTGGCTTCAACAATCACCACATTGTCGCGAAGTTGGCTTTCGGTTTCATCGAC
TAGCCTATCGGACGACCACGGAAGCCGTTGTTTTGTCCCGTACTGGCCAAGTCCCAATTCGTGAGCAGTGTCTTTCATTAAAGATTTTGTGCTTTGCAAA
GTAAGTCGGAACTGATCAAGTGCGAGAGCTTTCAGATCAGTGCCAGTCTTGCGGGGATCATTTGAGGTAGGAGATAGTGCCGTTGCTGTCACGAGGTTAG
AGGACGTAGTCAAGTGTAACTTCATCGTTCCATCGAGTATCCGAACCTTTGTGATCTTCTGCAGTTGAAGTTCCATATCCAAAGGTGTTGCTAGCAAAAT
TTTCCCTTCACCAGAAACTGGTGGCCCCGCGGCAAGAAAGCTACGCGAGAGTTTGTTTTCGTCCAGTTCAAGCGTCATTTTGAGCAGTTCTTCAGGGCAG
ATGGACCAAAAGTCCATGCTTTTTTCGAGTTGCTTGGCGTAAACTACTTTGGCTTCTACACCGTCGCTTTGGATCCGCTCAACAATCAAGGACATCGTTC
CAACTATACGCTGCAACTTAGACTCCTCGTGGTGCACGCCAATAATCGGCTCGTCTTTAGTTTTGCCCACATCATCGTCTTTAGGTTCGCCATCACCACC
CACTGAGCGAGAGACACCAATTGTTTCCATTGGAATTGTGACGATTCCGAGCTTCGCCTGTGTTTTCTTATCTCGAACAACCAGCTTCACCTGAGAAACA
CGGTCCAAATCAATGGTAGGGTACTTAAACTCCACTGAAAGAGGGTCGTTCTTAGCTTTCCAAGCCAGCGGCGACGTCGGCGATGTGGTAACCGCTGTTG
TCCATATTGTTTTCGTGCCATCGCTTCCTCGCCTAAGCGTGACAGTATAATTATTCGGATCACCTAGCAAAATTTCGCCAGCTGAAGAGAGTTCCAAACC
AAACGGTGTGGTaatcttcttgtcgttcgCCATGTGCTTTTGAAAGTCGCTTGAAATGagcaccacttccaccagtAGGCCGTCAATTCCCACTTTTTCT
TTGAGAGTTATGTTGCTCGCTTCCAGTACTTGAACACGGAGCATGTCGAACTGTACGTCAGCTCTCGCCACGTCAACAATAACTCCATTTCTGCTGGTGT
CTGCATTGACGCGTTTAGTATCTGAAGGGATCTCGATACCCTTTTTACTCTTCACGGCTTTAGCGGCATTCACGGCGGCTTCGCTACCCTTTTTACTCGA
GGGTGTCATGACGAATTTAGCGTCTGCGTTCGGCGTGATCTCGCTAACAGTTTTGCTTTCGATGGTTTTGAATTTAACCAAGCAATGCGTTGACGAACTG
GTGTTCGCATTTTCCGCACGTGAAACAAGTTCAGCTGTCTGGAATGGAGTGGCTGCTCTACGAACTCGAGCTTCCGCCAAAACGTCGTGTATCCGGAAGT
ACAACTCGTGGGACTTTTCGTCGGAATCACGAGCACTAACACGGATGTCGTCAAGAGGCTCAAGGGATACTTCGGGCTTCAAGTCGGATCGTCCACTTTG
ACTACTGAAGCTAACTGATAGTGTCATGCCAGGCTTGGGCGTGTCGTTAGTAGTCCCAAACACCCATGGCATCCTTTCCAAGTCCGCAGCGTCTGCCAAT
TGTGCAATTCCCTCTGCAGCGAGTGTTTTTATTTCTTGTAGCCGCTTCGAAATGTCCGTAGCATTTTTGTATGCAGTGGCCAAGGCTTCACTGACGTCGT
CCTGATCAATGAGCGGTATGGATAGTCGGAACATAATGGTAATGTTTGCATCCGACAATGACATATCGGCCAGATCTTTttcaagcgcagcagcatcatc
gTTCGAAGTTGACGGCATGAAATTTAGTGCCACATTACGGGAtgcagtgctgctgaactCCACTTTCACGCAATCAATAGTCACACGACACTCCTTATAA
TCGGGCTGCAGGTTGGCATTACATTCTGCACGCAGTAGTCGCTGGAGGAGTGGCACGACTGAGCTGGGATTTTTCTTCAGAGTAGCCAACACCACCGTCT
TGAAAAGTGCCTTTGAATCGGATCTTATCTTGACACAGCCGTGCACATGCACACGTGGCAGCGGAGCGACGATCAGGGAGAAACAGTTGTTCGTACTAAA
TGGTGCTGCGCCAATTGAGAATGCGTTGTTCGTACGACGATTGCACACTGCACTGTACaccagcttgagctgttTTCCCTCTGTTTTGTCCAAGTTTTCC
CCCTTCACAAAGCCATGGTACTGACCGACGAAATGTGGTTGCGCTTTGCTTCTCTCTGTCAGTTCTGTTGGGAGAAGCTTGTTTGTCGTCGCATCGCGTA
CTTGGATAGActtcactgcagcaggaagcatTGCGTACACCTGTACAATTTTGTCGCTACCCCACCAAAGATTTTTTTTTGGATCTGACGGatccaagca
gcacaactCGGAGCTGAACGTTGCACCAAGAAATGCTGTATCAACAGCGAAGAATTCTTGCCGTACGCGAATCTGATTGCGCACCAAACTATCGACCAAC
TCGCCATTATCGAGAAGCATGCTGTACTTCACTGCGGTAGAAGAATCGTTCGTTTGGACGGTCGAGAGTATTTTTCCGTCATACAGCATTCTATCCGTCA
CTGGTTGCAAACGTTCTCGTCCGACTGACCCCTCTTTCGTACCATCCTGGTACATGATATCATATCGCGCGTTACCGTGATTGTACATGATCTTTGCGGG
GCGCAGCGATTCTGTGTTATTCACAGACCTATCCGGGGTGGAGTCTGCTGTTTCATCATCACTCTGAAGAGTACTAAGGGTCGATTGACGTctctcctcc
atcgtgaCAACATCGCCTGTACTAACGTGCACGTAGTCTTCTTTCTGAAGCTGACTCTTCAAGATTTCGCCCTCTACATGCGAGAAAGCAACATGCATGG
AGTCACGTGCTCGCCACTCTTCGCGGGGCTCTCTTTTGTCGAGGTATTCCACCGAGCATAGGCTTTCCGGGTGGTGTTTTTCATCTTGTGTTACCTTTGC
AAGACGACCTTGCTTAATATGATTCGCGTTTAACAGCTCCGAGTTGCTCTCATCACGAAGAGCGCACACGAACACAGTTTCCTCAGCGCCAATGCTTGTG
AGTTCGATATCGTAACGGTCTCCTCCACATTCTTTGACAAtcacagcaccaacaaacTGGCCACTTAACTGCACATCCACAGGGACTCCAGCGTGTTTGA
ATAAAGGCAATTGAGTAGTGACTCGGTCACCAACGTGAAGAGGGCTCAATATTTCCTCAAAATTGTGCTGCGGGCTTAATGAGTCGGCAACACTATTACC
GACGCTAGGCCCACCATTCAAGGACGCGAAATCAAATCCAGTCCAGTCACACTCCGTAAAAAGTGCCTCGATCAGACGCGATGTCTTCTTGCCATGTAGA
TTCCCAGTCAAATAGTCTTTAGCTTCAGTCACATGAGATAATATGCGAGACCATCGATTGAGCACAGCGTCCAGAGCAACCGTGTGGGTGTACGAAAGTC
GGTCTTTCTCTCCACTCATAAACACGAATTCAAACACGTAGCCCAGAAGCTGAGGCGTAACTTTCCAGTGAAGCTTATTCGTTTGGCTCATGATGCGCAC
CTGAGCTAGCAACTCCTCAGCAACACTTCGACCAAGGAAAAGATTTGTTCGGCACGTGTCCCACAGGAATGCTTCTACGTCCTTTTGTAGTTGCTCTGGG
ACGTACCGCCCGCTGCTCTGATTAAAGGTTCGGGAGTCAAACTTGAGCCCTACCAAATGAAAAGTATCCGCCAAAATTCTTCTGACGCGGTCCGCTCGAA
GGATCCCAATCAGGTTCAGATCAAATGTCAAAGTCACCGTTTGTTTGGACTCTCGGTCTACCAGAACAATCTTTTCATCTCGATAGTTTGCACGCTGCGC
AGGATTTTTGAGTGAGAACTTTGGCTTATCCTCCACATTGCCGGCTGATTTTCGCTCCGATTTGCGATCTGCCTTACCAAGTTGTCCCTCAAATACCCTC
CCCTTTGACTCAGAAACCAAGCAAACGTCAAAATAGTCCACCTTTGACAGATCGTATGTGCGCCCAAGGATTTTGAATGCTCCTTCAACTAAGAACGAGC
TTGCGTGTGGTACCTTTCCAATTTTTCCGGTATCAGAACTCACAAGAGGTGCAGCAGAACGGAGAAGATCACTGAGCTTGTACGAATTCCCAAATCCAAG
ATCTTCAGCTGTAGGCTCGTACTGAATTCGCATCCCTCCTTCACCATGAGGCTGAAAGTAGCACGTATACTCGCTCCAGTCCTCTTGTGACTCAGCATGC
TTGATCGCTATCTCAGCAGAGTACGTTGTTTCGATCTTTTTAACGCTCAGGTCCACGTAGTTTTCGTTGCGCAATATCTCCACCAGAAACCGCAATTTCC
CAAGCAATCCGTCTGGCGCGGGGGTCTTTTTCTTTGGCTTCGActgatctgcagcaggaagaagcatCGCGTCTACTTCTACACGATTTTCTCCATTCAA
CTTCAGCTCTTCTATCACGGAGTCTCCAGAGGCATCAGCCCTCTTCAGCACTAACCCCCTGATGTAGCCCGTCTCGCTTCGTTGGAACTCGATAGTCACG
GAGCCCAACGGATCATTCGCCGAAGTTGCGTCGTAGTCCATCACACGTAGCAACACAGCCTTCTTGTCGCTCAGCATCGTTTTGTCAGACTTACCCAGCA
GGAACTCTTGGTTTTCCCACTTCGGATTCAAGGTTTTCATCTTTATGTCAGTCTTCAGACTCGTGTCACGCTCCTTCTCGTTTTTCTCATCCAACAAAAC
GATTTCCACAAATGGGTCGCTTGTAAAAAGGTCTGCCACGCGCAGGCTTCGCCCCTCCAAGATCGAGATCTTAACAAACGATGGTTCCCGTCCCAGTGCA
AACGGATTTTTGTCCTTGGCATCTCGACCAGCCTTACCCCGTGGACTCAGCTTGCTCTTATCTTGTGGCGGCGGTGTCGATACGTCACTTATGGCTTCAT
GGGTTACTAACGGGACCTTCGCACTGCGTTTCACCTCTTTCTTTTGCACTAGCTTGAGCATCACCCGTATCTGACCAAGGTTTGTTTTCTGAAGCATGTC
ACTGGCAGGTGCAAGAGGATACCATGCATCAATCGTACGGTGAGGTGAAATTGTCGTGATAGGGATCTTGAGAACACCAAGTGGCTTGTGGTGGTATCGA
AGCTTCAGCATTCGCGAAACACAGTTCTCCAGATCGGTAGCCTTGAACAGAATATTGAGCTCTGTGCACCTATCACTAACTTTTTGGGGGTCCAGATCTC
CTTCGTTCGTGCGAATGTGCTCCCGCATCAGCCCTTCCTCGACAATACGTTCGTTCGCATGACTGTACTCCACGTCATAGAGTAGGAATATGTCACGCTG
AGACTGCGGCAGGCTCAACCAAGACGCTTTGTCAGTCACCTTGTACTTCGCTAAAAGCTTTATTAGCTCATCTGGAACGTCGGTTTTGTTCATAATGTCG
TACTTTGCTTCGAACGGGTACTTTTTGGGGTCAGTGAACGGAGTGCGGATACGAATAAGGCGTCCCGAGTATAACGAGTCCTTCTTGAAGTTTCCACCAT
ACACAGGCTTTGATTTCAGGTTCTTGCCTTTACCATAGTATGCCATCACTGTCTCGCCTTCTTTAcccgtcttcttcagctcacTTCGCACTTGCGCACG
AAGGTCacgtcgcttcttctcgtggtcATGCGATCCCAAGTCGTGACAGAACAAACGATTGAGCAGCCGGTGAAAGCTTCCTTCGAGATCATTAGGATCA
AACTCTGTGGCATGTTTGTTACATTTTTGCTGCAGAATAGTTGGGTTTAGCCGCTTCATGAGTACCTCCTGGCCTGGAAGCATTTCAACGCGGACGCCTG
AGCGTGCAAGCGCTTGAATCCACTTGTAGGTATTTGAGGTCTTAACTTCAATGACCTTATTTCCTTTTTCTCGAGTTTTTGCCATCTTGTCGAGCATTTC
AGTGGTGATGGGAACGAAGTCTTGCGAGTCTGCCTTCCGCACGCACACCGTAGGGTTCACAATGTCCATCCAACCGCCTTTTGCATCGTTCGCGAAGTTG
TACGCTACTTTGCAGGCTGCACTTGCCATATCAATGTAGGCCATAGGAAAGGTGGAGGTTTCTtgctcgtacatgtacaagtgcCTACGACTTGGTATGA
AGAGGCAATACTTCCAATCCCACAAAACATTTTCAACAACTTGCGAATATCCATCGGTCTTTACAGCGCCAGATTCTTCGGTCTTGTCAGCGCTACTTTC
CACAGATTTTCTAGCGACGGGGGGCAAGAGCGTGTTCTTCCAACTCTTGACGGAGGACAGTACATTAGACAGCAATGTATGCATGCCAAGGAAGCCATCA
CAGTGCTCCGTGAGTTTTTTTGCGTAAGCCTTGTTTTTGTCGCTGGTAACCAGCTGCTCTTTGTCGTTAGAGATGTTAGCTACCGACAATGGTAAGGCTG
GAGCACGGTAGCAGTCAACCTCCCGAACAAGATCCAGCGGGAACAAACTGCTTTCAAGTGACAACTTGTCCATCCAAATGTTTACATCGCGCAAACGGTA
GAAACGATCCGCCCTGTCTTCCATTAACACGTGCCTCTTGCCTAAGTCGTCCAAAGCAACGATTCCCGGGGTCACGTTTTCCACAAATCCAGCGGCACAC
AACGCACTAAGCCATTGCAACGCACTAAGGTCGCTTTCTGGTGCCTGAATCGCATCGGGATCATCGTTTAAGTTCGGCTCGTGCCAGCCTAACCAGCACG
AAGACTTCACCGTGGGGTCCTGGCAATACTTCTTCCATCCGTCGTTCCACAAAActgaaggacgacgactacgGATCCAAGAAATTATCCCTTTTCCCGT
GAAACTCCGTGGGACAGAGAGGACCGATGCATTTGTATGGTCTCGCATAAAAAAGTTGCCATTTTCGTGGAGAAATTTTTGGCGCTCATCTCGTAGACGT
AACCACTCCTCTCGTGATGTATTGGAGTCTGGGTATTTGGGTAAATCACCCTTTGGTGCTGCCAGTTCCAAtagctccatctccagctgTACCACGATAT
CTTTTCGTGTTTCCAGAGGTAATCTGTCCATTGTATATCCAAGCCACTCGCTATTCGGATCAGCGCTCACTGTGTGAAGTAGACGGCACTTCCGCATCAC
TTCACTGGAAAGCTTTTCGAACTCCTCAAACTGACGGATCTCGCGCAGAATGTTGGCAATACGCTTCATAATGATCACGAGAATTGTGTGCAATGCATCG
ATTTGCGAGTTCGCAGTAGGTGTCAGGGATGAACGAAGAATTTGCCGCCGCCTGATCCAAGTCATTCCGCGAGTATACATCGATGATGATTCAGCTTCAA
TGTCCAATTGACGCTGGTACCATGTGCTTAATAAACCATCGAACAACGGGCGCACCTTGCTATCTTCTGCTGTGGTTGCCGTTTTAATTTGTAGCGGCAT
AGGAATATCGGACCGTGCTGTGATACGAAGGAACAGAGACCCCACGTAATTGCAATAAGGCACGTTTGCCGTATCACGAGGGACAACTCGCAGATAGAAG
TCTCGAGGTCCAATTTCCAGCATGGCAAGATCGATTTTCACAAAGCCAACGGTGTGATACTGAATTTCAGCATCCTTGTTCCCCTCCAGAACTTTCGCAC
CCTTGCCTCCCTTCTTACCCTTCGCGTTCTTATTCTCCTCGtgaactccagcagctttgccTCCCTCTTGAATGACCTTGTTCTCCACACGAATCAAAAT
GCTTGAAGCCTGTCCAAGCATTTGATACCCCATTCTGGCTTCCTTTTCATCAATATTCGCATCATTCGGATCTACCCTGCCAATCACGAAGTTATGCCCG
AACACGTGGGAATGGCTGGTTTGGGCGGTCCCATCCTCTATAAGAGCCTCCAATCGTTTGCCAGACTTCCAGTTCCAATTGGATGTTTCCAGTGTTTGAC
TCGAGAACAGTTCGCCCTCGTCGTTGAAATAGCAGAGATCGGGCTCAGTCTGCTTTGGTTTGCCGATCAAAGTGATCCGACAAGCAGGATTATCGAGTTT
CTTTAGCTTTAGCGGTTGTCCATCCTCTTTTATAGGCATCAAAAGATTTGATACTGATAAAACTTCAATGGCGATTCCGGATAACTTGTGCTGCTTTTTC
ACCCATCGATCGCCTCCTTCATTGCTCTTGTCAAAGTGCTTGGCCATCACCGCATCAACCTTACCCGTTAAGCTGTTTACCGGAACGAGTTCGGTAGACT
TTGTAGTGTGACGTGAACTGCGTTTGGTAGAAATCGTACTTGCGGACAGCTCGTTTACGATGCTCACGTCGACTCTGCCGTCACTACGCACCGCTTGGAC
GACTCCTTTTACATCAAAAGAAATCAGGTTTCGGAGATCATCAATCGTGTCGATTTCATCGTCGAAATGAACTTCATATTCATCGTTTGGAAAAGGAATG
TACTTCTGAACACGCGCGGGGTAAAAACGTCCGCCATAGTCGCCACCGCGAAAAGCCAACACTTGTTGGCCGTATTGGAAGATCTCGAAACCATCGTCGT
CTATCTCTCCAGATGGCGCCAGTTTGTGCAATTGAAAGCGCTTTAGGCATGCGTTTGGCTTCTTCTCCCCATCGCTAAGTAGTTTGGCAAGAACCTCTTT
CTGGTCACTCTGCACATCCCGTCCATACAGGTGGAGAGACAAATGCGATACTTTGGCGATGTCCTTGATCTTCCCAAAAACGAATTTTTCCTTTGGCCAT
GACGGATCACGTGAGTTGAAGACAGTTAGACTCTGTACTTGTTCCGCATCCTCCAACGTCCCATCGCTACGAAAAGGAACAACGGTAAAGTAAATGTTTG
ACGCGCCTTGTAGACGTCCAGCATTTCTCTGGTGCTCACTTTTCGTTGAATTCTCGACATCATCAAGCTCAGATTTCAAAGACCCAAGGTTGGCACCAAC
TGCATCGGAGAGCAATAAATTCCGAGCTTCGTAGACACGCAACTGAAGTAGTTGAGTTTTAACGCTTGGGTACTTTGCATCACTAAATATTCCAGGAtac
gagagcgagagcgagaacTTTTCCTTGCGCCACGTTGCCGTGTTGTCGCTAAGCACCTTCGAAGTTGAGGTCTGAATTGGGACTCCACGCTGGATAAGTT
CAGTCGTCTCGTCTTCTAGCTCAAATTCATCAAAATCCGCTACAGACATGGTCATCTCCATTGAGGCTTCACTTTGAATATTGGCTTCCGAGAAGCTGAG
GATACTCAACGATTTTTCCATGGGACTAGTAGACATTCGCTGCATTAGCTCCGTCAGCGCTGTTGCATCTCCAATCACTTGCGTCTTAACACACAGCTCT
CCTAATTCCTTGGCATGCTTTTTCATCCAAGGCTCGGGTTTGAGCTCGTATCGTTTCGTCACTTCTCTGGACGAAATTGACGTGAAGTCTGCAGATGCCC
GGCAAAGATCGTACAAAGGAATTTCCACACGCCCAAGTGGCGTGCTTCTCCCAAAGTTGTTGTGATCCTTGACATGAATCAGCAGTGACCTGGCCTCTGA
AAGCGGTACATTCTGTGTAAACAAAGAAGCAAGAAACATAAATCAGTGCAGTTGTTCGTACAACGTAAATCGAATCGATACGGTCCTACAATGTACCTTG
CCAAACACGAAGCTCTCGTTGGTCCACACAGGATTAAGCGTTTTTGATATCACTGCTGTCCGCTTCTTATCAGCTTCGATCGCCTTTCCTGCAATACGAT
CAGTGATAGAAAGCGTGCAGTACGGATCACTGTAACCATTCATATCGGCTGGACTGAGCCCATGTCCCGTAAGAATTTCCACCTTCAGAACCGGTTTGTC
AGGATTGACCTCCATCGACTTTTCCGATCGCATCTCGTTTTTCACAAGCTTCGTTCGATGTAACGATACTTCCGCCTGAGCGCGCTTCGAAAACATAGTG
TTGCGTgcctccgctgctgctgctgcaatccGCTTGCTTTTCAGTGGAGATAATGGTGCGCTTGTACGTTTGCACTCCTCAACACATACCGACGGGTCGA
TCTCAATAACCGCGTATGGAGTCGGCGTGCTACCCGGATCACCAACCTGTTTTTGTTTCTGCTTCAGATCGGATGCCTGAATCACTGTCACTTCGAGCAA
CGCCTGGCCTTCCAGACCAGTTCGTGCTTGGAAGCTTTCATCGGATGATGACTTCTCTCGATGCGCGCGCGAAATTTGTGAGTTTAAATAGTGAATGCAC
CCGTTGATACCATAAAAGCGCGGGTCGCGGGACTGGTAGTCCGACACTGCACACGGAATCCGCGCCCCATCGAGCTTACAAGCGGCATCATGCAGCTGAA
ACTGAGCATTCTCGTACTCGAGTTGCTCGACCGACTGGTCGTGTGCTTTCAGTTTAACTTCCTTGTCGATCTTCAGCCGACGAGCATGTTCGCCGCGCCT
CTCGCCAATCAGCCAAATTTTTAGTTGGATCTCACCGAGATTTTCTCGAATTGACATGCCTTCTTCGGGTTGGAGTACGTGCCATTCAGTCCACTTGTGA
GCTGAAAGTTGATCCAGACTGATCAATACAAACCCAAGAGGGTCATTCCGGTTCGACTTGTCGTAGTCAACAACACGTACTTTGAGGCTGGCTGCCGCTT
CAATGTGGCATATCAAGCCAAATACGTGGTGCTCGTCAGCCCACGCTGGGTTTCGCGTACGATGCATGACGGCAGTTGTTGCATATTCGCCCGGTATGGG
CTTCCCATGGTCATTCAATAGGGTCAGCTCGCAGTAAGGATCCGATGAATTGTTGAGGTCGGAGCTGATGAGCCCCTTTGCAGCTAGGACGGTAACCTCT
AATCGGTTATCAGTATGTTCACTGCTCACGGTAGCTACAGGACTCGTCGGTACGAACTCCAGCTCCGAGTTGTGGAAGAAATCAACAAGATTGGGTCCAG
ATATGTTCATCCGAACACGCAGCTCGCCCCAGTCTTTGACGACGTGCTCCTTCTCTCGGGTGTCATTGCGTcgtggagacgacgaggcgCCAGTTTTCTT
TGGCGGCTCCAGACGAAACCAGTCATCAATAGACTCAGACTGGGCCGTGCTTGCTGGTGACATTCGGAACCTCGAGAACGGCACCTGCACCGATCCCAAG
CTGTCGTGCCGCTTGAACGTGTCATGGTCCCACAAGTCGAATCGAATGGCCTTCACCGAATTCAAGTCAACAACTCGGCCAATCTCGAACGGCTTTCTCC
ATGCTGGCTCTAGTGTTGCAGTGATCACTTCTGTGCGTTTCTCCTCGATGTCGATGATCTGTCCATCTTTGCCCACTAGTTTTACGACACAGTACGGATC
GCTTTTTCCGTTCATATCGGCAGCTTTAAGCTTACGAGCCTCCTCAACAACAAGTTTGAGCAGAATCCGGGACGGAGGggcaggtggtggcggcgatGGT
GGCTGAGTAGACGTGGGTCCGAGTGAAGGGGCAGCGTCCGCCACCTTTAGCATTTCCGGGGCGGAAGTTTGCTGTGCCACATCTGGAGTACGGCGATAGG
CATTGTAGATAGCTGCGATCCACTCATCTTTCTCCACCTCATTTTCCGCctgcatgaagaagctggatTGCCCGGGTGCAGGCTGGAACACGATACAGAG
CGGGTATCCTTGGTCATTCGTTTGCAGCACATTGGAGTCCAGTGTCAACTCGTAgcggcgtcgtggagctAGGTCTTGCGGCGTCTTGTAGTACAGCAGC
TCGGTGCGAGTCAAGCGGAAGTACCTGCGCCTCCAGTTGGCCATGACTCTGCTGGAACGGCTCCGCTTCATCAGCCATCCCTCCTTAAGGTAGCGTTGCT
CACTCATCGCGAGGGATGGCAGCAACGCAAAGTTCTTTCTCTTCTACTTGGCGAACTtactctctctctctcgttCTCCAGTTTCACTTGCGCAGTTCTT
CTCTCCTTCACTCCCAGTCCTTCGTCACTTGCGCAGGAGCTCGATTCTTCTCTTCTGAGGCAAAAGATCCCAAGTCTTGAAGCGTCGTCGCGTCCCTCCG
TGGCGCTTTGGGTGGTTACTGATCGTGATCAACTAACTCGTCATACATTTCGTATCCTGCTCACCGGACTAAGTATAGTTACGACTTCGCTCTTGGAGGT
CCTTTCTGGAAGAACAGCGGCGGCGGGAGCTCTCGcgggaacagcagctcgctcttGGCAGCAACGCCTCGATCCACTCGAGGATTGTGCCTTTGAGTTC
CGCGTCGTGAGCTTGCAacgctcctgctgcttttATAATAAAGCATTGGTCCCTCGACAGTCAAGTCCTGGGTCTTCATCATATTGTCAACTGGCCGGGC
GTTATCACCTCTGCCACTCGACAACGAAGAGGTCGATCtcgcatcatcgacaagcaTGTCCTCGTCACATTGGACGCTCGAGTCTtgcgtctccaccttc
ggCTGTTCTAGCACTGGTGTCTCAgcacatgcagcagccgagtcTTGCTCCTCCTCAATAGcagtctccttctcctccttctcgtccaccgcAGTGGCTG
GTCGCACCTTTGTCTCTTTTGGACTCGATGGTTGCGACTTGTCCACCTGCACGCCCAGTGCCTGCGTCAGATGCGGAGCCAGAGTCTTGCCCAGACACGA
CAGCGTCACAGATCCCATCACACTCCCCACAACTGCATTGTGATGGTCTCGGAGCTCCCACGAGCCGCTTTGACTCGCCCACTCGCAGATGCGATGCAGt
tggctgcagctcagcaCGTCTCCGTCTAGCAACCCCACGTGgagcgacagcgtcacggCTGCAAAAGCTCGGAGCCTGGCCCTGCCATAATCTttagcca
gcagcagcagcgtcagcggcGCTTCCGCGTcccgctgcagctcgtgcactAGCTCGTCCGGGTCCGCTTCGAAGAGACAGGACTTGCCATGACGCAGACT
CGTCACTGCGGCTTCGGCTGGAGCTGTAGCAGCCTCGTAGGAGGCCAACGAGGCGTCGAACATGACGATCtcgtactgcagcagctggaacgcTACGAGC
AAGGAGGACGCGGGCGATTGAGAGGACGCTACGGGGTTTAGAGCCACGCGATCGACGTAGAATTGAAGCGAGAAGAGCAGAGAAACAGATCGAGGTATAG
AAGACCCACCGGAGACACCGTTGGAGTCGCAGGACGCCACGGAAACCAAGTGCTGCGGCGCACCATTTTCGTCCATCTGTAGGTTCAATTCAACACTGCC
CAAATTTAACTTATCGTTACGTATCTGATAATTTGTATTTGTCGGTTATTCGCATTAATGACACCCTGACCCTTTATAATTTAATCACATGAACTTCAAT
CCAATTCCAGAGGTAGAGCTTCATTTCATCCATCATCATCCATTTAGCGTGTCATGATGTTGCgtcgcttcttgagctcttcctcttcctctgcctCTGC
CTCTGCTGCGCCTCGcatggtgcagcagcaggtacaGGGCCGTCTGTCTCTGCTGTCCAaggcctcgtcgtcgcccaaCACTCGCGTGGTGTTCGTGTCT
CGCTCGTCGGCCTCAGAGCTGCAAAGTTCGCTGCCCTTCCCCGTGTCTGCCGCCGCTCTGAGCGACTTCAAGGCCAAGCCGCAGGAGAAAATGTATTTGT
ACCCAAGtgtggacgacgccgagttcAAGGACCAgcgtgtgctgctcgtgggGCTCGGAGACGCCGAAAAGGTGACGCCCAACGTGCTGCGAGACGCCAC
GCACGGCGCGTTGAGTGCTCTGAAGTCCAAGCGAGCCACGGACGTCGTGGTACAGGTGCCCAACCTCGAAGGGTGCGAGCTGGAGCCCAGTCgagtggtg
gagctgctgtctcaATCCTCGATGCTGTCCAACTACCAGTTTGACAAGTACCTGACGGAGTCGAAGGACGCCAACGGGGACAGCAAACTGCGTCTGCCAC
TCGAGCAGATCTACGTGGACGCTTCTGCAGAGTTCCAGAAGGTGAGAGGAtgagtgtgtgtgtgtggggggggggggggggtgagGAAGTGGTAGTTATT
TGGCTGACGGTTGTGTGGTGGTGTACGCTGTAGAATGTGGCGGAGCATGCGACGGTGGGCGAGGAGACGATCTTCGCTCGCAACCTCGGTAAGTGGGCTA
CAGTAGCTTTTGACGTTGTTATGGAGTAACCCTTAACTGATTGATTGATTCGGCACTGCGCTGCAGGCAATGAGCGCTCGCATATTGCGAACCCGGCGTT
CATGGAGGAGGTGGCACGCGCGTCGGCCGATCTTCCCAACATGTCGGTccgtgtgctgcagcaagaggaTCTGGAGAAGGAAGGCATGAACATGTTCCTA
AGTGTGGGCCAGGCGGGTGTCTGTCCTCCTCGTCTCGTTATTCTTGAGTACCGTGGCAACCCCGACTCGGACGAAAAGGTCGCGCTGGTCGGGAAGGGCA
TCACGTTCGACACGGGTGGCTTGAATCTCAAGCCGACGGGCTCTATCGAAGACATGCACACCGACATGTGCGGGTCGGCTGCTGTACTTGGAGCtgttcg
tgcagcttcgCGCCAGGGTCTCAAGGTAAACATCGTCTGCGCCCTTGCCCTGGCTGAGAACGCGATCGGATCCAAGGCCGTGAAGCCGCTTACGATTGTC
AAGTCGCACAAGGGTATCACCGTGGAGAACAACAACACGGACGCCGAAGGCCGCCTAGTGCTTGGTGACGCCATGTCGTACGTCCAGAAGGAGTATAAGC
CCAAGAAGGTCATCGATGTGGCTACTCTTACGGGCGCGTGTATGGTCGCTCTGGGCGAACACTGCGCTGGCTTGTTCTCCAACTCGGACGacttggccaa
gaagctgcaggagacaGGAACGGAGTGCCacgagcgctgctggcgcctGCCGATTCTCCCCGAGCATTCCGCCGCCCTCAAGGGTTCGCAGTCGGACTCC
CGCAGCACAGGTCGCGGTCGCTACGGTGGTGCCTCTACGGCAGCAGCTTTCCTACAGCAGTTCGTCTACGAGGGTGTGGACTGGGCTCACCTCGACATTG
CGGGACCGTCGAACTACAGCGCTGCCAAGTCGTACTTCCCCAAGGGGGCCACGGGCTTCGGCGTCCAGCTACTCTACAGCTACCTGAAGGAGTATGAGCA
GCATTAGAGGGTGTCATCCTTCACTGACCGAGTGCATACAGTGTCTCAAGATCCGGTATCTGCGACGTGTTTGCTGTTACTCAATAGAAATGGCAAATAT
GAAAGGCGTGTTGTTGAAGCTATCAGGTCACGTAAAGGATGACTATTGCTCTGTGTAGAGGTTCCAGACGAAAACGCAACCATCATCACCGACGGAGACG
AGCTGTCGGTCGTCCGGGCTAAAGGCCAGACCACAGACATTGCCAGAGTGCCCCACGCCGTCCATGATCAACtggctggtgttgaagtCCCAGAGTTTAA
CGAGTCGGTCGTTTGCGCCAGTGGCAAATACTTCCAGGTTGTGCGCCACAGCAATGCAcgttgcttcttcgtcgtggGCCTTCTGGATCACAGTCACAGG
GGTGTCAATGCGCAGGTCCCAGTACGATATGCGCTTCTCCTGGCCAGCACTCAGAACAAGACGCTCGTCTTCAGACAACGCTACGGTGTTGATTCCGCCC
ATGCGCTGGATGTGACTTGAAATCCTGCGCTCATTGCGTAAATCCCAGCAGAGTAGACTACGATCTCGACTGCAAGAAATCACGTGCAGGTCGTCGCGAT
ACATCACCAAGCTCGTGACTGCCATCGAATGCTCTTTGAGATGTGAAACCAAGTCACGCTTGCGAATATCCCACACACGCACCTCACCGCCGACTCCCGC
TGACACAATAAAGCGCTGATTGTGGCTAAGAACAAGTGCTGTAACCCCACCGGTATGGGCGTTATCGATGGACCAGGCCAACTCACCAGAATCACTGCTA
TGAGATCGGATGCAACCCTCACTCCAGCCTGAGATAAGCACGTCCAGCGAATATTGGAGGGATGTCGGTGCGCCGGCATTGCCGACAATGCAGCGGGTCG
CGACGGTGTAGTCTGAAGCATCCCATACGCGAATAGTGCAGTCTCGAGAGATGGTAGCGAATCGATCGGACACGTCCGGAGCATAGGCTATCTGCACGAC
AGCGTTCGAGTGGTTTTCAGACAGCAATCCAGCCTGCAGGCTGCGCTGTGAGGCTCCAAACGCGAGACGCACCAAGAATATACTTCCTGCTTGGGTGCCA
GCGACGATCTCATTCTGTCCTGCGTTGAGAGCCAAGCCGACGACACCGCTGTCAAGTACGACTTGGCAAGTGTCAACGAAGTCATGTCCGTAGTGCAGAA
CACTGCCATCCCCACCGCCCACGAGTAACCCGCCGTCAAAGTATAAAATCGAGTTCACGCCGCAGGAACATGCTGGAACTACCTTGAATAGCTGTCGAGT
CTTCACACCAACAACACAAAAGTCAccactggagctgccggcCACCAGAAACTCGCGGTCAGGCGAGAACTGCACGCAGGTGTAATCACGAACGAGTGTC
TGCTCGATCTTGTGCTGCATGAGCTCTCCCGTGACTGGATTGAGGATCCAAAGTTGTAGCAAGCGATGCCCAACCGTTGCAAATTGGTAGTTGGTAGTGT
CTCGGCGCTTTACGTCACGCGCCATGCCTCCGAATGCAACCGCGGTGACGATGTTCGACATCTTCTGGTGCGTGGCACAAATATTGCCTGTCAGGACGTC
CCAGATGTACAGCCGTGGTCCGTCCTCTGGTACACCCACTGAGCACAGCAGTCGCTCGTCATCAGAGAACGCAAGCGCAGCGATACCTGCATCGTGCTCC
GATAGTCGGAAAGCGAGCCTTCGTGCTGAATAGTCCCACACGAGGATATCTGCACGCTTGCCGCGCTCGGCCGAGGCTAGCAACCTTCCTGAAGGCGACA
TGGCGATGCATGACACAGGACCCTGATGACCTCTCAGGAAAAGCTGGCTGTGCGCGTCTTGAAAGGATGTAAGCAGCACGGATCCGCCAGCTGGATACAC
GTACTCTCGTCCCGATGGGTGATACTGAATTGCATTTGGCACAGCAGAGAATCCAATGGTGTGCTCCAAATCAATCGCAACGGAGAATTGCTGCTTGTCT
AATCTTTGGTGCGGTTCGTTTGATGCTACAACGTATCCTCTTGAGTTCAACTTGCCATCCATGACAGGGACACCTTCATACCCACGTGAGTTGTTGCCAC
CATCGTACTGCATTGTCCCCAGGGTCACGAGCGACTTCTTGATACAATCAGCAATGTGAAGAGGCTGTTGTTGTCAACAACGACTAGCAACCGAGCAGAA
GTAACCACTAAAAAGCTAAACATATATCCCGAAGTTAGCTAGCGTACCTACTCAAGCAATGCCCCGGACTCCAGCAGCCCCGTGGCACCTACATAACTCA
AGCACGTATAGTACGGAGGTAAGTTGTACTCCTGCATCCACTGAGCCACATCCAGGCCGATATCTTCCTGCCGGTCGAACAAATTCAACCGCAGAACTCC
TCGAGACAAAAAGACACGGCACGGTAGCTCGAACGTTTGCATCTGATCAAACTACGAGTTAGTACGAAGAAACAAACGCTGATAATGACAATTTTGCCAG
CATCACAGTGTTCCTTACCTTCATATCCTTGACAATACTAAACATCATGGACTCATAGACCAGCGTGTCGAcctctccgtcgtctcccAACTCATACAGA
GCGAACGATAGCCGCTTTGGGGAGTACGTCGGGCTGCCAGGGTACCAAAACACTCTGTACGGCACAACCTGCACACTGTTCACCAGGGAGTTTCCCCACA
GTGTGTAGTCCAGATGATCTGTCGATGTAAACCCCCACGTCGAGGCACTACACAACAAAAGAAAAAACCAATGAGCATCTCTAAAAAAacaccttcacca
cctccactCTCCCCACACCTGCTCCAATAGCACGGTCGACCTCTCGCACAGCCGCACTCGAACTGCAACCTTTTGGCAATCACTTGAAAATCCGCGGGGT
CGTCTGCCACCGCCGtgttcgacagcagcgccaccccAATGCCGCAATGAGACCTCGTCAGCGTGTTCTCCGCCGACTCGTTCGTGTGGTCCACCGACGA
GCATTCTGTCAGGTTCAGCAGGTTGAAAGCATTGTTTTAGCAAGTCTGTAGTGAGTTGCAGTGAAGTAATGGCCTTGAGTTCACCTCGCACCCGACGCAG
CACCGAGAGCTCTTCGCCCACGGAACTCTGGGTCAGCAGAGCAAGGTGCTTCCAGCCGGTGGAGCTGCGGGCCTGGTAGTCGTTCGCGTACAGCGCCACA
CGCTGCGCTAGATCCCGCCACGTGTCTGAGGACAGAGGAATCAAATGAGGAGAGGGGAAGGAAGAAACTTGCTGGCTGTAGAAGACGCACCACCGTGGAC
GATGATGTCCCGCACGCAGCGGTTGACGGACTCGAGCCGCAGGAGACTCGTGTGGTCGGCGaactgcagcatcgccaccagCAGGTCTCTCGGCAAGTCA
CACAGCCCCATCacaagcttcagcttcagaATTTTTTCAAGTGATCGATTGTAGCTTCTGGGCGACAAAGTTGAACTTATTACTGATGTTTGTGGAATCT
GATACTGAAAATAATTTGATAATATAGGATTTGTGATGTTAGTAAACTTGATAGAAGTAGATCTTTGAAAACTAGTAAATGTGTATACGTTATATAATGC
AATGTGACAggaacaacttcaacatttcATGGTATCACTGACGTGGCGCCCATACGGCAAAAGTCATGAACAAGTCAAGCTATCAACGTGTTATCCCCTG
CTCTTTAGCTGCATGTATACACTTGTTGACCGATATTCTGTAAAGAGGCCGGGAGCTGTTCACACCACTGCAGTCTAGTCGTCCCACCGATTCAGTGCCT
GGCGAAGCATGCGCTGGAACTGGGAGGTGGCGGCCcgctccttctcgatctccACTCGGAGACGCTTCATCTCGCCCACTGCTCGGTACTTCTGCATCGA
CTTGTCCACCGCGTTCAGAGGTCCAAAGCTCCGCCTTACGCTCTGCACGGAGACTTGCACGGGTTGCTTCACGACAACCTGGTCACGGCTGGAGTTTTGG
CTGGAAACAAGGAGCTGCTTCGGCGTCGAGGTGTGCACACCAGCATCCAGAAGCCTCGATACACTCGCTCCAAACCCGCGCCAGTCAGCCGAGTAGTAGA
TGGTGATGTCGCTCAGCGTCTCGAAAAAGGTCTCATAGATCTCCTCGAAGATCTTCCGCCATGGCAGCAACACATCCGCCTCTCGTGGGGTCACCTGCTC
AGTCTTGCCGTCTTGTGTCAGGCGCGCATGAACCGGGAGAAGCGCGCTGTAAATcctcttcttgagctcgtacGTCGACACAGCTGTGGATGCTGGATAC
GATAGGAACAATCGGTCAATGAAGTCCTCCACCTTTTTGAAGTAGACGTCACAAGTTTGGTCGCGGTTCAACGGGGAGGTCACGATAACGATGCGAGTGA
CTTCAAGCGCCGCCAGAACCGTTCGAATCTCGTGTCGCCTCTCTTGCGAGTTCCAGCCTCGCGGGGGGTCCACGacagcaaactgcagctctgGAGGTGG
GTAAGCGAGGTCCATTACGCCGGACGACAAAACGTCTTCACGCACACGCGGGAAAACAGTGCAAATGTTGCTCTGGATTCCCACTGACGACTCGTATTGG
TTCATCATCGCCTTGACACTGCCCTCTAGAAGCTCCTTCAGACCGACGCTCTTGAGGTGATGCACAGGGGGAGACAAAGTTGcaatcttcttcagcactt
GCCCGAACTTGAGAGGAAGAAGGTCGCCTGCGTCGATGACCTCGACGCCGACATAAACCACCTGCGAAGCGAATCGGCTATGCACTCGAACGATACAGTC
CCCAAGCGTGCTGATGAGCAGCGCCCGTGAGGACTTGATTTCCACCGAAGCGAACCCCAGGGCAAGTACTGCCACGCGGCACCCTGTCTTCAGCGATGAT
AGTAGTTCTTCAACTCGCTGCTCCCAGCTACTGCAATTGCCAGATTGCTGTAATGTACTCAGATCTACGGGTAGTAGGAtcgccgacgtcgctgcgAGCT
TGTCTTGCTGTGCCTCATATGTATTCCGCTGAGTAAACGTCGAATCAAGATACCGAGTGCACACAGCAATACCCTGCGCCATACCATTACTCGACTGAAA
AGTGCGATAGCAGTCGTGCTCAGGTGTAGAGACATTCTGTGTCCCAGCCCTGACAGCGCACCACAAACCaaacgacgaagaagctccaTCTAGTAGATCT
GCTATCACCAATTTCCACGCGATTGATGGCACCCCGGGGTTTTGCCGACGAAGTGGAGCACTGGCCAGTCCTAGGATGTCTTCGGAGCACCAAAGCGCTA
AAAGCTCTGCATCTGAATGCGACACGTCCTCTTCCACCCTTGAAAATTGCTTCAATCGCTTTGTTCCAATCGGGGTACCAGATACGCCGTTGACTCCTCT
GAAAAGCCACTGCAAGCTTTCTTTTGCCTTTTGATGAGGCCGATCAAGTCGAAGCTTAGTTACATCAATTGCAATAGGCCCAGGACCGTTGCGTGACACT
TGCACATACTTCTTCCAGAGGTGCAGTCTCAGTTTCAGAACAGCGAGTCGCTGCTTTTCAGCGCGGCACACCCTCTTCCTTTCTGCTCGCTCCTTGGCTA
ACTGTGCTTGTCGTTGCgcttcaagtgcagcttCACGGGCTTGACGTGCTCGCGCCTCTGCTAGCTCTTGCTGGCGACGTCGCTCAAGTTCTTTTGCTGC
CTTTCGCCgaatttcttcttgtcgtttttcttcttgtcgacgtcgctcttcttcagctgcctTTATCCTCATCGCTTCggcttgctgcagcgctgccagT
CTCTGTCGCTCCGCTTCACGAGTGGCCACTTCAGCCCTTCTGCGCTGCTCTTCGAGTTCACGCAGCTTCTTTTGTTCGCGTAGCTGCGCTTCgagctctt
gctgttgtcgctttgcttctgcagcttcctttccagcttgagcttgagcaatTACATCCTGCTTCGCCTGTTCTTCACGTTGAGCAGCCTGCTCGGCGGC
AGCTTTTTTAGCTTGATCTCGTCGagtcttctcctccttcgctTGCTCCAGCTCTCGCATTCGATCTAACATTGcttgcttcttctgctcaagctccagc
tTTCTCTGAGCAATCATTCCAAGATCATGTCTTTTCTGATCGGTCTCCGCTGGCTGTTGTTGAGTAGAAAAGTTCTTTGCAGGTGATATTTGAGCACTCG
TTGAAGGCGCCATGGAAACTCTTTCGTTGTAATCAACGAAATACGAGTAGGCATCCTCATACTCAGGCCGGTCCGGGTACAGCCTAGCCTGTTCCTCCCG
TTCGGTGTCTTGGATCAGCTTGCTAAGAGCTGGATACTCATCGCGGGCATATTCAGTCACTCCGCGGCAGATATCTCGTCGTAAGTAATTTCTGCACAAA
GCAAGTAAATAAGTGAGAACAGGTTTCCCTTTGCAGCACACACTAGCACTGAGCTATGCGTACCCTTGCTTCATTCCTACGTAAATTTTGGAACTTCGAA
TCTTCAACGGCGTATTGTTCCTTCGTAGTTGGACATCTGCACCAAAGTCAACATACAACCGTCACTATACGTGCCACATTTTGCAATCCTTTAAAACAAG
TTACATCCGTACCTGTTTCAAAATCACCACCGAACTTCACCATAACTGCGCTGTCATCGCCAACACCAGGCCTGCCAGATACCCTCAATTGATGTTCTTG
GCACACTGAATAGGCGTGCTCAATGTCATCAAAACATAGCTGTTCCACCAAGTCCTCCAGTGGGTAGGTTTGGCTGCGATAAGCTCGATTCATACGAAGC
AGTGCCGACGACCGGACATTCGGAATGTATCGGAAGAGCAAACACGATTGCAGGTAGGTCGCTTGGCGTAGCAGCGAAAAAAACTGGAAGTAGTCACCTG
TATGGCGAGCAACAAACACACGCATCGCGAACTTGATGTGGGGGCTCTCCAAAATATGACGCGGAAGATCTTTCACATACTTCAGCACATCCATGCCGCG
ACCATTGTCCAGCGTGCAGAGGATGAAATACGCGCGACACTCAGCCTCGAATGGACTTAAGTGCGCGGGATCTCCCACCTTGTGGCTTTCATCGTACAGC
TCGTTTAGCGACTTGAGGGTTTGTCCGAGCTGCTCCATGTTTTGCTGAGCCACGAAACTAGGCGTCTCAATTAGTTCATGCTCACTGAGAACGTGATACC
GCGCGATGCGTTCGTGGATATCAAGAGCTATGGGGTGCACACGACCCCCGGCGCCACGGTAATTCTGCAGGACGAAGTCTTTGCGAATCATTCGAAACCG
GTCCCAGCAGATGTTATACAGCTCAATCGGCTCCGGAACTCGAGGCGTCTGAAAACGTGGATCCAAGCCGCACTGATCCAGATCCATGATTGCCTGCTCG
ATGTACAGCTGAGTGCGCCGAAGAACACCAGGTGGGCGGATCTCCTCCGGAATATCCAATTTGTGATCAGCTGAACTGCGCTGGAAACGCTTGATAATCA
TATCACGTTCGGTTCCTGGTCGATCAGGGAAGCACTTTTCGAAGACGCTCAGTTCATCCACCCGAATATGCAGCTCCCGTTCTGCTGGACTACACATATC
AGCACAAAGGCCATCTAGGTTCGTAGCTGCAGATAGTTGGGCTTTGCTCTTGTCGTCGCGAGCCGAGGATGCTGCAGAGGGCATTGGAACAAATGGAGTC
TCTTCATCACTTGTACACGGTGCTTTTTTCTTTGGTCGAGCTTGGTGATGCTTCCCATGCTTTTCATTTGTTGGGCTCGACTTAGGCACCTTTGCAGCCC
CGAAAGCATCTCCGTCCGGAAGAAATTTCTGGTTGTGTCTAGGCATCGTCTGTTGCCCACCAAAAGGGTTTGCGTTTTGTTCCGACGAGGCACCAAATGT
TTGAGCGTGTTTCCCCTGTCCGAACGATGACTTTTTCGTGCCACTCATTCGCGCCTCCATTGAAGTCATCTTGTCCAAAATACCGAATCCCCCTGCTGAA
GCTTCCGAGCCAAATTTTGGAGTAGACTGTCGTCGATTATCAGTGCCTCCACCGAATGTGGTAGCAGGGGCAGTGCCACCTGCAGGAGAGGACCTTCGAA
CCGCTGGGGAAGACTTGAAACTATTATCGCCCGCTGCTCCGCCAAAGGTTGTGTGAACAGTTGGGGCGCTTGAagcaccgccaccaccggctgctgcagc
aaaaggATTGTCTGCACGGGCAGAGGTTGCCGCATTTGGAGTGATCTGCTTCTTTCGTACTCTAACACCTGCCGCTTGGTTTCCAAAGGATGTACCTGGT
GACGCCAACGGTGTCGGGGCCGCTGCACTACCAGATCCAAATCCGTTAGAATCTAGCGAGAAGGAGCCCTGTCCACGCTTGGGCGTAGGCGCCCCGAAGG
TAGTTTGCCCCCCACCAAAATCATTGTCGTTCCCATGAAACGTTGTGCTGTTCCCACCAAAGGTTGATGCCCCATTACCGCGGAACGCAGTCTTCGGTGC
ATTTCCACCAAACTCAGACCCTCGACTCTTGGGGTTTCCACCAGCCTTCGACGCAGATCCAAACGTCGTGTGTGCACCTGCTGACGTAGAAGAAGGCACA
ATCCCATTCTGTCCGAACGGAGTCGATCCAAatgtcgtcgttgagctgctcggtgccttgttcttgttgctaGTCTTCTGTCCGAATGAATTTCCACTAG
TTGAAGCTCCACCAAAGCCACCCAAAGGCATCGGAGGTGCACCAGCCATGCCGCCCggaggcagcggcggctgGCTGCTAAAGCCGGAGCTCTGTCCGAA
CGCCGTCTTCATGGCTGAGGCGTTGGAACTGGACTGGAAAGGGTTCACTGCTGTCGACCCTGGACACGCGAAGGCAGCGGACCGATCAATACCTAGAGAC
GTCTACAGACGCATTGAAGCACAGCTGCGACGACGTAGAGAGAGAGCCCGCGTCCGTCCAGCTACAGCACGAGTATGCCCTCCCTCACGCACAGAAAGAG
AGTAACCGTAACCATATAACCTTCCGTACCTTGATTTTGACCGAATGGGTTACTGCCCTGCGCTCCGAAGCCTCCGAAGCCGCCGCCTCGATCTACAGAG
TAGCCACAAAGGTGTATCAGCACGTAATTCGGTAACCACGCGGACGATTGAAGCGTGGGAAGGCGGATAAGAATGATGAATGTATGCAGAACGCACTGCC
TGAGCTGAACATCGCGACGCCGTCCAGAGAGCTGCTGTGTCGCCGCCGAGAAGTGTCGTCCTCCCTGGATGCTCGAGTCAGGTCACTTTCGCTCGTTGGA
AGCTCTGTACCCCCTCGAAAGCGGTACCGTGTACCGACATTGAGAAGTAACGTGGACTACCTTATGTTCGAGTGTGTCCTAATTCAGGGAGAAAAAAGAG
CGATATGATTGGCTGCGGTTTTTGGGCATAGTGGGGCCAAGTCAAGTCGAGGACTGGAGAGCCTTGCGCGTTGGGGAACCACCAATTCTCCGGCCGCTAA
CCCGCTGGCTGTTGGTGGGCTCCAAGTTCCAAATTGCCCGCAACTTTCTGAGTAACTTCGCGCGAAGGTAAATCCGCGCATGTGTTCCCCCCTGGGCACG
TagccaagatgaaggagacTCACCTACCGTGCCTGTCTGCCTTACTCCTCTCTCTCTGTAGTTGAAAGATGGTGAAGCACAACAATGTCATCCCCAACGG
CCACTTCCACAAGTACTGGCAGTCCCGAATCAAGACTTGGTTCGACCAGGtaagacagcagcagcaatatccaCAGCCAGACAGCCAACTAGCAGCTAGA
CACACACACGTCTGGAGTCTCTTTCTTCCGTCGGTGGCTTCTTCAACCATTGAGAGGGCGACACAGGAGGAGGTTTACAGGTCAACCAACCAATCACTCG
ACGAGAAGAACAGACAGTAGCTCACTAAGCACCTAAGGGCCGACGGACAGAAGAGGCCCATGCCGGCGTGTTGTAGCTACATAGCTGGCTGACTGGCTGG
CTGTATATCGTCTCCGGATCTACTCGAGTCGTGTACTGATTCCTGTTTtgatcgctgctgcaggcttccaagaagaagacccgTCGTCTGATACGTAAGG
CCAaggctgctgccatcgcccCGCGTCCGGCCGCTGGTCTGCTGCGCCCCGCTGTGCACTGCCCCACGATTAAGTACGGCTCGAAGGTCCGTGCCGGCAA
GGGCTtcacgctggaggagctgaaggaggctgGCATCAACCGCAAGCAGGCCATCAGCATCGGCATCGCCGTGGACTTCCGCCGCACCAACAAGTCGGTG
GAGTCGCTCCAGGCTAACGTGCACCGCCTCAAGGCCTACAAGGCCAAGCTCGTGGTGTTCCCGCGCAAGAGCAACAAGCCCAAGAACGGCGACTCGGCCG
CTgaggagaccaagaacgCCGTGCAGTACACGGGCCCGATCCTGCCGATCACGCGCTCGAGCATCAAGTCGACCACGGCCGTCATCACGCccgagatgaa
ggagaagagcgtGTTCACGCAGCTGCGTGTGGCCCGCGCCGACAAGCGCATCTTTGGCAAGCAGGCCAAGCGTCTGgctgacaagaaggagaagaagtaA
GTGTCGTTCGCGTCAACACGTGCTAGCCTGCTCTCTTGACCGACTTGTTGTTGAGAGAGACGGCACTCCTAAGGTCTTATGCGGAAAATTGGAACACAAT
ACATCGCGCATCAAAAACATCTCGTCTCTTTATCGCGTGTCTGTGCATTTTGAGTCTTTGCTGGTGTTAAAAGGGTTAAACGATGATTACAATGAatact
tcttgctgcttcgaaCTCTATCTCACACTCTTTCGTCTGCATACGCTTCTGGCTCTGAGAGCAATGGCTGCTTCTCTGGTTCGTCCGACAGCATTCTAAT
CGATTTGAGCTTCACCCGACCCCCTCCAACGCTGGTGTTTTCGGAGATGTCAACCTTCTTCGGCAGCACACAAAGGAACACCAAGACGAGTAACTGACCG
ACAGACGAGACCACAACGACCAGCCACAGATGACTCCAATCCACAACCTTCGTGGTCGAGTCCGGCACGATGCCCAGCGCCAACACCACGAAGGAAGTAA
GTACTCCAGACACAACGCCGCCGAAGTCCATGAACGAAAGATACAACGCGTACGTCAGGCCTTGGACATCATGGTTGGATGGACAGTAGTATGTGGCCAC
AACCAGCAACTGCAGTAGCGCGAACTCGGAGGTGAAAGACGTGATGAACGACTCAGCTGTGCCAAACGTGCACACGGAGACTGGGAGATCAACGACAGGC
GGGGCCAACAACAGTCGCGGGAGACCAGCGGCAACGGAGCACACTGtagagaagaagaagacgcttCGGACGTTCTTGTTGGTACACCATTTGGCATACG
ACAGACACGAGAGGAACCGCCCGATCATGCCAGCGAGACTAATGTACTGCAAGCACTCGTGCTCGTCTTTGAGGAGCGAGAACGTGTACTGGTACCAGAT
CGTTCCATCGTCCGGCAGCGCATTgcacaggaagaagaagagcatcAGCGGGAGCACAGgcttcacgagctccactTTGTGTTGCAGGTCGCGTTTGAAC
GGCAGCCACCACGACTTGAATGTATTGCTCCACGAGGACGAGGGGACCATCCCACCATCCTCAACGTGTTCTGATTCACTGTCTCCAAGTGCATACACCG
GTGTCTCCTTCAGTCCAACTAGACACACGCACGCCGCTGTTAGAGGCAGCATACTGGTCCATCCGATCACCTCTTGAGGCCTGATGCTCTTGTCCTGATA
CACTGGGATGCCCAGCATCAATGCCGCAATCGAGGCGGCGTTCTTCGTGCCATTGGCCAATGACTGCACGTGGGCGCTGCTTCTACTGGTCGCGTCGCCC
GTCGCCAGGTCCACCAACAAGATGCCAAGCATAATCTGCGCGAAAGCTTCGGCGACGGCGTCCACAAGCTTCACGACGAAAGCGCCGGCGATAGAGTGAA
CGTATGTGGCTGTCAGCGCCAGTGACGTGGCTGCAAGGGCCTCGCATAGGACGATGTAGGACTTGCGGCGGTACCCGAAGAGCGGCAGACTGTCGGACAG
CAGACCGTAGAGCGGCTTGAGGTTCCAGGGGAAGAACGTGACCGAGTAGTagagcgtcgtcgtggctgGTGGCATGTGGATCACGTCGAAGAGCCAGTCG
CCGTACGCCGTCATGGGGAACgtcatgaagaaggcgtgcAGGAAGtagagcgccagcagcgccagcggcACCCGCATCGGCGGTTGCGTCGGCATTGCCA
AACAGGACCCAGCATCTGATTCTCAGACGCTTCAAATCGGGACACATTACCACGAAATGGCTACAAGCGTATCGAACGGTACTTATCGAAGCTTTGATTG
GCGAGGAGGAATATGCATCGCTGATTCGTTGAAATTAGGTCGTGCATGGTGCTGCAAGACTGCTTTCTATTGCCTGGCGGAGGACGCTCAGAGACTGTAG
GGACGTCATGGCGcgcgacgagttcaacatCGACGAGGCTGAGGACTTCGATGACGGCACGCGTGCCGTGCTGCACGCCGCCGCGGCGTCTGATTCCGAC
GCAGAAGCGCAGGATTCCACGCGTCTGCGCTTGTCCCgcaagcaccagctgcaggcggcgcAACGCACGGGCggcaagcagcgcgagcaggcGTCGGCCC
TGCGCGTCAAGAACTGGGACGCGGGGCTGCTGGAGAGTAAGCAGTACGCGGGAAAAGTGGTGAAGCGCAAGGACCTGAACGATGGTGAGGAGTCACCCGA
CGAGGACGCGATGGCCGAGTGGTCGGATGCGGAACCGTTCGGAGcgtcggaagatgaagaaggagaagaggaggaggtgctggaggaggaggaggaggag
agtgaggacaacgacgaagacaagagcGCCGAGATGCTCATCCGGGGCTTCCAGAAGGAGGACTCGGCGCGGCTCATGGGCGCGCAGGACAGCGAGAaga
tcatggagaaggccaagcacGTGCGCCATCAGAAGCTCATCTGGGAACGGTGTCTGGAGGTCCAGATCTACACAAAGCGTCTGCTGACGACGGCGAAGGA
CGCGGTGGCACATGAAACGACGGATGGAGAGACGACAGATGAAGAGGCGGCTTCgaacaagaaggagcaaGTGGTGGCGGAGCTCTATGAGAGCATCGAG
GCTGTGTCGGCGTTGCAGGAGAAATTGTGCAACGTCCCAGAGCTGAATGCGGGCGACGCACCGACCAAGAAACGCAAGCGCACGTGCGACGAGCTGTGGC
AGGACATTACGACAAGCAGCCGCGCGATGCTGCCTCAGTACAACGACATTCTCAACACATACACACGCAAGACGGACCTGGCAGCAGGCGGCAAGAACAA
CCAGGCGAAGAAGTTCAAGGCTGTGAATCAAGACATCCTGGCACAGGTTgagtcggtgctggtggatcCCCAGCGAGTCAAGCGGAAGGCACACGCTCCG
TTGGATGTGCCGGAGGCTGACGCTGTACAAGGCGCCGAAGAATTGCTGGACGAACTCATGtacgacgactcggacttcTACCAGCAGCTTTTGAAGGAGT
TTATCGAGagtggtggaggtggcgctggccagGACGCCATGGTGAGGCGCACTcaccgcaagaagaaaaaaatcGTGAACCGCAAGGCAAGCAAGGGCCG
CCAATTGCGCTACACGGTACACCCCAAGCTGGAGAACTTCATGTTCCCGGAGCCTTACCCGAAGCCAGAGATGGACATGACCGAGCTTTTCCGCTCGCTA
TTCGGTCAGGTTCGGCAGTAGACAGCTTGACATTGACATGCTGGCTGAAGAATAGATTGATTTTGATCATAAAGTGTTGCTTTGTTAGCGTGCTTAATGC
TAACCACTGTAGAAGATGTATCGCGTAAAGTGCCCTCCCTTATATTCCTACGCCAGAAATTGGCGTGCCGCATTGTGTTCAAAGGAAGACACCCCAGTTC
CCTTAAAGCAcatcgtcctcttcttcctcttcctttTCGCCTGTTAGGTACACCTCCTTGGTCTTAGCTAAGTTTGCTTCCACCTCCCGCAGGCGCAGTT
CATTTACTCCGTTGGCGCCAATCTTCATTACAATGCCCACCAACGTGACCGCCTTCTCAGCAACATGTACTACGGTCATCGCTCGGATTTTCTTGGCTCG
TGTTGCATTTTCCAACGACCGGAACTCTTCCTCTGCGAAGTCCATCGAAGCATCGGCTAGCACCGTCGTCGAGTCGATGAGTGCAGTGCCACGCTCTTCA
AAACGCTCAGGGATGTTAAACTGGTGCAGTTGCCGCACTTCCGTGGCGTACGAGCCGCTCTTAAATATTTTGTGTTTGAGCTTCACCGTATCCTTCAGTA
GCTGCGTGAACTTGTCAATCAATTCCGGTTTTCCCTTGGCCATCGCACGCATAGTTGCAGGAGCATTAAGAATTTGTGCACGCTTTGCAATCAACTGGCC
AGCATCGCGTTCCAAGAACGAAAGTCCCCACAGCCGCCCGTAAGCCTTGCCAGCGTCCAGCCGTTCCTGCTCCGAGAAGTACCAGTCTCGTGTgtccttg
ttcttgatgaGCAGACGCGACGACCAGGTCTGAACGGAGTCGGGACCGAGAGCTAGTCCATGTTCCTCTAACTTAGGGGCAATCGTTTTGTAGAAGGAGA
TCGCCTCTTCGTCTGAGGACAGCTTCGCAGTCAACATCTCGGCCACCAAGCGGTTTACTTCCCCACTGTTCTCCACAAGCTTTTTGTTGCTCTCCTTtcg
cgccttcttctcaagctgctcgatcaTACTCATTCCACCAGGACCCTTCGACTGCTGGGATTCGTCGCCAaagatgtcgtcgatggcgCTATCCGCAGCA
GCTAGCTCTTGAGCCATTTGATCTTCAACTGATCGCGGTGGTATGCCGTCTACTGCTGCACCGCCACTGATACCGCGACCACGCGCTCCATTTGCGAAAC
TTGAACCGTTTGACACTGCATTGACCACGGAAGGAAAGCATACACGACATGTTAATAGGATCACACGTAAGCAAGCCAACTATGAATATATGTTATACCA
GCTCACCTTGCTGAatcatcatctgctgctgcatgagaaTGCTGAAAAGCTGCTCCATTGAAACAGGTCCGGTAGGAGAGgctggagcttgagcaggcGG
CTAGTTTAAGTGCAATGGACAATGTTGAAGTCAGTCAAATTTGAAAAACAAACACCAGCCTGATAACACGAGTTGTAACTTACGCCAGGGTCGTTGGGCG
ACACGTCGTCCGGGTGATCAATCAAATCAGGGTCTACCTCCTctgccttcatcttgagcttgatTTGCTCGTCGGGCATGCCCATTTTCCGCAGTTTAAA
ATACTTCGCGAGTTTCGGGTCATCTTTTACGTAAAGTGGCTCGTAGGGAACGACAggggctgcagcaggcatTGAGGGCCAGCTAAAGCCTCCGTAGCTA
GATCCTGGCGGTGGAGACAGCGGTGCGATTCCATTCGACGGATACCCCGCCGAGATTTGCAGCGGCGGCTTCATCATATCGAAAGTTCAAGCACATTAGA
TAACGCAGATTCGGCTAGCAATATCGAAGTACAAACTTACACCAGGGTCATTCGGTGACACACTATTTGGCTTGTCCAGCAATGTGGGTTCCACGCCATC
CgcctccatcttcatcttgatctGATCAATCGGCATGTCCATGcccttcaacttgaagtaTTTCTTGAATGCTGGATCGTCCGCCACGGTCAACGGGATG
TACGCACCCTTCTCCGGCTGCCAACATCCAAATTATAGGCAAAAACCAAGCAGCACATTAGTCACCACACTAAATCAAAtaaaagaagaagaaaaatcGT
CTACGTACTCCCGAGTCGTTAGGAGACATGGCATCCGGCGTGTCTAACAGATCCGGACTGACGCCATCTGcctgcatcttcatcttgatctGCTCAATCG
GCATGTCCATGcccttcaacttgaagtaTTTCTTGAAATCCGGGTCGTCCTTCACCAGAAGCGGCGTGTAGACACTTGTGGCCACTGTCATCATGCCTCC
TGTCTGCGGCGCATAGGCCACCGCttgcgtcttcttctccagctcactcaacttctcctgcagcaccttgatctccttcaaACTTGCACCTGAGGTTCCT
CGTTCCCGAGTTGCACCACCGTTCTTCTGGTCGGCCATGAGCTGCGAtatctgcttctgcagcttgtccaAGGACGAATTGGTAGTCACAGTGTCCGTTT
TGGTcgccaagtccagcagcttcttgatctgaATGGGCGTGAGTCCGGGGACGGCGACTCCtactgctcctgctcctgctcctcctcgacctGCAGAGAG
CGGGGCGTGGGCCACATCTTCACTCTCCGagtcgctctcgtcgtcgtcctcgtcgtcggactcttcctcctcctccttctcggccgCTTCTTTCTCCATT
CTCAGCTTGATGCACAAGTTGCGGTGTGCGCGGGCGTGTCTCCTCTTGCAGCTCTGTCATAGTAGGACAGCTCCTCTCGTTAGTTAAATGCTACGTTCTG
CTTAGTCTTTTAGTCCGAATTGAGGACGTACTTCGCTGCAGTAGGTCGCCTTGTCGCAGATGGTGCAGGCCAGCGAGGCGTTGGGTGCCGCGCAGTAGGC
GCAGTCCTCGCCTGAGCTGGCTGCGAAGCCCATGCCCATGCTGCTCGTGAGGCGGCACATGAGctcatcgtcactgtcgctgtCCGCCATGGCTGCTTCG
GAAATGAGGCTAAGCTTAGCTTACTTCGGGTCTGAGTCTGTCCGAATtccaactgcagcgtcgttTCTCATGTTGAATTCGGCCAAAAATACCATAAACG
GGCCGAGTCGGAGCATTCGATTCCTGTTTTGTTTTTAGCTGCTTGCTGATGGCCATTGACTGTCGGTGGAAACCTCGGGGAAAATCTCCTAGTTTGAATG
GCGATAATTGTCCAGATTCGACAAGTCTAACGAGTGACTCAACTCCGTGCTCTGACGATCCTTATCTTCCGAATCTCCTGGATATCCGAAGCTGGAAAAG
ATGCAAGTGAGTTGTACGAGGCATGGGTTTGATGAAATGAGTGTCATGTGTATTGCTCTGCTAACAGTACTAAGTATGAATAAATATTGCGGCGTTGCCA
CAGAGCTTTCGATAGGAAGCTCTGCATCTGCCCACGTTCTTCGATCGAACGTGGCTGGCCGCTGCCGCTTATATAGTGTTAGTCTTGGAAGAAGAGGACT
GcacttcgtcctcctctttTAGGCTGCTGCGCGGGACAAGCGGCGCTGCGAGAGCATCCGCACCATGTCCGGAGACTTGTCGGTTTCGCTGATGTTGAGC
ATGTAGTCCGATCCTACTTGCTCGCTTGGAACAAGGCCCGAGAACCGCTGGAACAACTCGCAGATGGTGGCGTGGCCATTGGCCTCGGCAATCATCAtcg
cgtcgctgtcgttcttcgtgcgcttctccgggtcggcgtcgtggcgcagcaggTACTCGGAGATGGCCAACGACCCCAGCTTGGCTGCGAAGTGCAGCGG
GGTGATTCCACTAGCGGTCATGACATTCACGTTCGCGCCACGCTCCACGAGCATCGAGACAATCTCGATGTTCTGAGAGACAATGGCAGCGTGAAGAGGA
TACGTGCCACGCTTACTGCAAGCTGATACCTTGGCGCCAGTgtcaagaagcagcttcaccacgtcAACACACCCGTTGCGGCATGCCGCGATTAGCGGCG
TGACGCCGGCATCGTTTGCCTTGTTAACGTCCGCgccttcgtccagcaggaGCGTCACAATGTCAGTTCGTCCCATGCGGGCCGCAATGTGTAGGCACGA
GGAACCGTCCGCCATGGTCGTGTTAGCCTCAGCGTAGTTGAACAGGATGAGCTGCACGGCGTATGTGTGACCGATACGGCACGCCACGTACAGGCAGATC
TCCCAGCGGCGCGCCTGAGTGAGCTCGGGCGAGTTCAATTCATCAATGTCGCCTGCGAACTGACTCAGCACGTGCTCGCAGAACTCCTCCATGAACGAGT
GCATGGTGTGAACGCGCACGGTTTTGACCTGCAGAGTCGGTAGTGGCACGCGCTCGGGGTCTacctccttctcttcactCGGAGAAGGCGTCGAGTCCTC
TGCAATTCGAGGCTCGACTGCGCGTGGGGTGGCGAGGTGTACACCACTAAGTTCAGGGACAGTGTCCTTGAAGCcgccgtcatcgtcctccacttcctcg
tcTTGGTTAAGCATCTGCTCGGCGCATTGTTGTCTCCAGCCATTCAACGCCAGCGGCTGATGTAACACGGCCGATGTGTCGACCGGAAAGTGTTCCGCAG
CACCTAAGAAGTTCGCGTACGTCTTGAGCACTAAACAGCTGCCGTCCTGCAGTTTTTCACGCAACGTCGCATTGGCAAAGGACCCGAAGAACTCTTGTAG
AAGCGTAACGAAAGCTGCGAGGGCATCGCGGCGCTCGTTGACGGCGGCGTGGTCGAGACCTGTCAGCTTGGAGCGGAGCGATCGGCGCGACGGGAACGGg
aacgactgcagcatcgGGTACAGCGCGTCGAACTCGCAGTGGTTCATAGTACAATGACACTTGTGTGCCAAGTTGAGCGTcaggtggtggtgacgtCGCG
TAGCTCCTGTCGGCTCGTTCACACGCTCGTGGAGCGTCTTCCAGAGGCGTCGGAACTGCGAATACGACCGCAACGTCGTGCAGACGCCAttgggcgacga
cgaggtcggCACAGGGGCGCGGGCGTCGTTCTTGGTGAGcttgatggcgaagaagacctTGCCGTCGGTGACCTGGTAGGAAGGCACGGCCACGTCGTAC
TTGTCGATCCAGCTCATGTGGCTACTTTTACTTGGTCGCTGTTCTCTTTGTCGTATTGGCAAGTGGCCGGAGCACTGGTTTGCTGGCTGTTGTCGCAGGT
CGGAAGGTGTTCGGTGGGTGAGTGATGTCGGCGACAGTTAACGTTAGATTATCTCTTCGGACGAAGCGAAGAGATAACTATAGATACCCCACCGAAGCAG
TAAATATAGAGCCACGGAACTGGTTCGCTTTTGCTGGTACGAGCTcgctgcaagcagcaagactACGTGGATCTTCTTCCCTGTTGGAAAGATGGAGATT
GGCGTCGGCCGTGAGTCTCCGGTGTCTTGGAAAAGCACATGATGTGCCGTGAACTCGCAGACCATCGTCGGACCGAACACTCCTTCAACACCCGATCTGA
TCTACCAATCGTTTCCTTTCAGACTCGAATTTTGGCCAATAAACGCGCGGTCCCCCTCACAATCGAATGAAAAAAATACGCAGTAGAATCGGACCGGCTC
TGTCGAACCGATATCTGGCTCAGACTCGTCGACCGCGACGAAACACGGTCTCCATTGTTACTGCGGGGCACAAACCCTTGGGCGGATCTGACCAGGCCTC
TTGGCATTCAGCACTCTTGCCGTGCACTTGCCTTCTATTATAATTTACTTTGGAACGACGTGTGCAATGGAGGAGGCGACTGAAATCTGACCGCTCGTTC
GGGCGCTGGGCTGTCCAGCCAAATGCTGGCAGCCTCAAGCTCGCCTTAGCCTCTTCGGtggtgatacatgtaccaacgCGCAGACCACACCCCTAAAAGG
AACGTACACTTTGAAGCAAGGCGAAACTCGTTACCAACCTTGTGAAAAAACCTTTGTATTAAACATTTTTCGGGGAGGCCTTATCGCTTGCAGCTTGCCG
AGAGCCGATCGCGATCGGATCGCGACATCCGATGGATTTTCGCAGCGTCCAACGAGTCGTGGGCTTTGCAAATGTGTCAGCGGTGAGGCCAGCTGGATTG
AACAACATGGTTCAGTCAAGTTGAGGTGCGTCAGAGCCGCAGGTCCAGTGGAGAGGCGAGCAAGTCCGTCCGGTGCACCGTGTTGAGCTCTGGGGCAGTG
CATTGAGCCTGCAGTAACTGCAGCGGGTCGAATCGCTTCTCGACACGATGTTGGCGGTGCGAGCTCCACGGGTGATTGCAATTGCAAACCCACGGACTAT
AAAGTATTATACCATGCACGTCAAGCCGAAAAACCGGATCAAATCGTTAGTGGTGGATTTTTGATGAACAGCGTCCGATCGAGACGTGTGCGACTTTCAA
AATTTTGGATCGGCGTACGCACCTGTCAAATCCCTGACAGCCACACTTGGGCTTCTTGCAGGCGAACGGTTTGCTGCCCGGGTCGTGGTCCGTGTGTCTA
TGCTTGCAGCGGCATCGCAGGATCCAGGCCCCTTCCGCCACGACGTAGAAGAAAGCTCGACACGAACACTTGGCAGAAGAGCACGCAAAAGCGCGGAACC
CTTCGGAGGATTTCACTCGAGGGTCATCGACCCTGCTCGGGTGTTCCTTGTATCGGTGTCCGCTATAATACATGGCAGAAGTTGCACTCACTTTTAGTTT
CCAGGAATGCCATCCTTTTGATCGTAGAAGCTTACCAAAGACACCGACTCTCTTCTCGAACTGGAACACACTCGCGCTTGCATTCGTTGCACGACCACTG
GATCACCGTCTTCGTGTAGCTCTTCAGTTTCATCGGAAACGGGGCTCCGGGTAGAGCAACAAGCTCGTCCGGCTGGTGCATAACCGGTAGCGTAGATTTT
CCTTTCAGCTCTGAAAACTCCCGCCTCAATTCCGCCATCGAAATCTCGTCCTGGTTGCAATTTGCTTGGGTAAGCTTAGTTGAAGTCTCAGCAGCTGGAA
ACGTTGCATCTTGAACTGCTTCAGACTTCAACACCCTCGATGATTGTTTCAGCTGCAGTGCATGAATACCCTGTTCACGTCTGATTGCATCGAGGCCTGG
CTCTGATTCATCGTTCAGCTTAGGTGCTTGCTCTTGTTGGTTTGGCGTCAAATCTCCTCGAGTCGCTGCGATGCGgtgcttcgacttcaaccgCCGTCTG
CCACTTGCTCGTAATTTGCTCTTCAAAAGCTGCAAGGACTGGGCCCGCGAGGCAGCGTTCTGCTCCATTGTGTGCTTATCGACAAGTGAAATCGGCTGCG
TCTCTTCGACTGCTCGGCCATTCAGGCTCCGACCATCTTGGTCGCAATGAGAAGAGCGACAATCGCGGCTTGCTGCGCCATCGCTGTGATTCCCACAACC
GCAGCGCTTGCTTGCAATGCTGGAACGTACTTTGATGGTGTCAAGTGTTCACGCTGTCCAGGAGGATCGTTCGGTGCCATACCAGGTCTAACGTCTCCAT
CGTGCTCCGGGTTGTGCACCGCTGGGTTTTTCTGCCCGGAGGGATCGACTTCATCCCGACAAAAGCCTTGCGGCACTTCCATCTTCTACTGTCCAGCAGG
CAGTGCTGAGCGTCGCCGTGTGGACGTAGGATACTACACGATCATGTTTCCAACCGACCAAAGCACTCTTCCTATGATCGACAGCTCGAaaggcggcgct
ggacggcaaaatCGCTGCGAGAAGGGATTCTACTGCGTCTTCGGAATACGACGAGTTTGTCCTGCTGGAATATTCGGAGACTCGACGAGAGTCACCACCC
CAGAGTGTTCGGCGCCGTGTCCGAAGGGGTCGTACTGCCCTGAGGCTACAGCTGTGCCGATTCCGTGTCCTGCCGGGACGTTCGGGGGCAAACTTGGTCT
AACGAATGCTCAATGCAGTGGACTCTGTCCGATCGGTCACTACTGGTACGTACGTTCAAACTCCTTGCAGTGCCATGATATCATCCGCTGTGAAGCTCAT
CTGCACCACTTAATTTATTCGTTGCAGCGGAATTGGGACGATCGTTCCAGTGTCGTGCCCTGCAGGGGCATACGGGACGGCACAGGGCCTCATCAGTTCA
GCGTGCTCGAATACGTGCTCTTCGGTCAATGGTGTGCTCTCGTGTCTGccttcaccttgtccagcaggaTACTACTGCCCGCTTGGAACACCAATGCCGC
TGGAGTGCGGAGCTGTAGGCGTCTTTTGCCCCGAAGGCTCGTCAGGACCAACCACTGCTGCAACGGGTTACTATACCACTTGGAAAGCGTACATGGGGAC
ATCCATGACCGGAGAGCAGCTTGCACTGCAGTACGTTGAAGGTTACGAGCTTGCCGCCCGAAACCAAACGACTCGATCAGCTCAGTTCATTTGCGAGAAA
GGTTCGTACTGCACTGGCGGCGTCAAAAGGCTTTGCCCGGCTGGAACCTACGGCAAAAGCGAAGGCCTGCCGACTGCTGCATGCACGGCACCATGTCCCG
CTGGCTACTACTGGTAGGGGAATGAATCACTGTTCATACAGCGACGAGATCTTGAGCTAACATTTGCATTCGTGTACTTGCAGTCCGCTGGGAACAGCAG
GTTACACCCAGTACCTGTGCGCGCTCCGGGCATCGTTCTGTCGCCAAGGCTCACCCATACCAATCGCTGTCGATACCGGATACTTCACCGTAGCGACGCA
AGCGGGGCTTCGTACAGACGAAACCATTTGCCCGGCTGGTAGTTTCTGCATCGGCGGGGTCCAATATCTGTGTCCTGAAGGCACGTATGGAGCCACTCCC
GGCCTTGCATCTAAAACTTGCTCGGGAAAATGCCAAGATGGATACGTGTGTCCACGAGGCTCTACCTCAGCAAAGCAATCACCGTGTCCAGCGGGGTCGT
ACTCACGAAATGGCAAATTCTGCGCACCTTGCTCTCCTGGGTACTGGTGTGGTGTCGCGTCACCAGATCCACAGCAACACGCCTGTGGTGCTGACAACAC
ATATTGCCCTCTTGGatcgtcagcagctcaacCCGTGCTTGATGGTTACTACGCAGTTGGACAAGAACTCAATACACACACTTCGGAGGCGTTGTGCGTA
CCTCGAAATGCTCCTCACCTTCCGCAGTGTCCTACAAGAACAGTAGGAGTGAACGGTAACTTGTAACATGACACCTTCCTTACCACTAATGCC