Description :
From Genome Similarity Track
Location :
Scaffold_446:11572- 12936
Sequence
1364 bases(100 bases per row)
CTAGACGAAATGTCTGATGGCGAGTTTAGCCAGGCCTTAAAGGCAGGAGATTTATCCGAATTAGTGGTCATTAGACCCGATGTCGAGTTGAACTCGTCCT
CGTCAATGGATGAGTCGGTCCTAGAGGACACCAAGGCGGCACTCAGTGCCCCGGAGTGGATCTTCGATCCTTAAGAATCCTTTGGATCCATTCTATACTT
TGGTAAAGGAATTTCAAGGTGTGGTGTGTCACAACCCACCATCTGTCTTACCTCCCGATAGAAGTGTACGTCATGAAACTGACCTAGTTCCAGGAACTAA
ATACTGCGTAACACGGCAGTGGCCTTTACCTAAGGAACAGTGTGACGTCATTGACGATTTCTTTCGTGCGAAGCACGCGGCGGGAATGGTGCTGGAGAGT
AAGTCTCCTCATTCCACACCTACATTTTGTGTCAAAAAGCCTAATGGTAAGTGGCCTATTGTGCACGCTTATAATAAGCTTAATGCTGCCACTATCCCGG
CTCAGACACCAATCCCCAGAGAAAAGATGTTCTTCAGAACAATATGGTGGGATCTACATTGTACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGCTG
CTCATGCGAGCAAGCGATATTTCGCTAACAGCGGTTAGTACCCCGAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTCAAATGCCCCGG
CTACTTTTAATCGTCTAGTGACGCAACTATTCAAACTTCATCGAGGCTATGCACAAACGTACTTTGATGACATCTTTGTCCATATTCGTGCAACGAACGG
TCGATCTGATGTGGATAATCACATTGATCATTTACGAGCGGTACTCGAGTGCATGCGCACGAATAAGTTGTATGCAAATGCATCTAAGTGCATCTTTGGT
GCAGAAGAGATTCTCTTTCTGGGGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGGACCCCGCCAAGATAAGGGCCATAGTCGATTGGCCGGTTCCAAGGA
ACCAAAAAGATCTACGTAAGTGGCTTGGCCTTGCCAATTACTTGCATAAGTACAGTGAGAATTATGCAGATATGGCTCGGCCATTATCCAATCTCCTTAA
GAAGGATGTGAATTGGTGTTGGGGTGACAACGAACATGATGCTTTTCAAGCAGTTAAGGAAAGTCTCCTTCGTGCGCCAATACTGGCTTTGCCCGATCCT
CAACGGCCTTTCAGTGTCATCTGTGACGCATCTGACTTTACCATAGGCAGTGCTCAGTTACAAACATATGCTGATGGACGCGAACGCGTCATTTCATTCG
AATCTCGACAGCTCAAAGCTGCTGAAAAGAACTATCTAATTCATGAAAAAGAGCTACTTGCTAT