Description :
From Genome Similarity Track
Location :
Scaffold_44:115711- 116942
Sequence
1231 bases(100 bases per row)
CCACGGAAGTACTGGCGCTCCATTTCGATGGAATTCATCTTCGGTCCTCCCGCCGGATACAGCCGGGCGCACAGGTGTACTTGTGTTCGTCGATCGTTTC
AGCAAGATGGTCCATCTCGTTTCCGGTGGCGGCCTTCAATCACCGCGGAAGAGTCCGCGGCCCACTTCGTCGACGTGATTTTTTCGTCACCACGGCCTGC
CGGAGTCTATCGTGTCCGACCGCGACCCGCGGTTTACATCCGCGTTCTGGTCACGCCTCTTCGAGCTCTTGGGAACCAAATTGCTAATGTCAACTGCGGC
ACATCCGGAGACGGATGGACAAACAGAACGCGTCAACCGCGTCCTTGAAGACGTTCTCCGCAGCTATGCAACTTCGTACACGAGCTGGAGCTCGTTCCTA
CCGCTAGCCGAGTTCACACTCAACAACGCCGAGCACTCCTCGACGGGTCTGACGCCGTTCTTCGTGAACAACGCTCGCCACCCACGTGTTCCGGCACTTC
TCGCCGTGGGTCACCCCACGGATGCTGGCGGCTCCACCCTTGGTGGGGGAGAACCTCCTTCGGTCGACATGGATGCTGAAGCTGCGCTCAGCTCTAGGGA
CAACGTGTCCGTGTCGTGGTCATCACCGGTACGTGAGCCGGTGTCTCAGCACGCACCGGTAGCCTCACCAGTGTCAACAAGCCTGCCGGCGCACTCGACT
TCAGGGTTATCTTCGGGTGTAGCCAGTGCGAACGCCCTGACTCGTTCTCCGTCCAAGCAGTCCATCGAGCCTCCTCGGCATACTGCATCTCCGATAACGA
GATGGACGTCGCAGAACTTGATCGATCCAGGCAGCAAGATTCGTGAGCAAGAAGTTACCACGGCAAACTATACACCGAAACCCTCGGTGCTTCCTGCCGA
TCGCTCGGCAGTTGCGGAATTTGTCATGCAAAGGCAATCCATCGCAAGGTTCGTCCGCGACGCACTGCAGAACGCAGTGGACAAGCAAAAGGAACAAGCT
GATAAGCACGGTCGAAAGAACGTGAATGTATTCAAGATAGGAGATCGCGTTCTCCTATCGACCGAGGGAATCCGCGCTTCCGCCATGACCAACCTCGGCG
CCAACAAACTTGCCCCACGCTTCATCGGTCCTTTTCGTGTAACCAAGGCTGTGGGCGACGCCTACACCTTGGACATCCCGTCGTCACTTAGACTCCACCC
GACGTTTTACGTCGGGCGACTCAAGCGGTAC