Description :
From Genome Similarity Track
Location :
Scaffold_303:11571- 13314
Transcript NameFunction/comments
Phyci_20148Hypothetical protein

Sequence
1743 bases(100 bases per row)
GGCACGCAGAGGTATGCAAAGTGAGAGCCTGGAGGTTGGAATAATTATTGGTTACGCTGGGCATTCTGGACAATTCGATACAATGGTACAATGTTTGGAA
CGGTATACTATTCAGAACGGTATAATACCAAATTGAAGATCCTCAAGATAGCCTAGGGTATTATACTGctcgcccgggcgggcgcgcccgggggtggaca
cagtacgttaggactgcgatcctgagctttgTTTTCCTGAGCTTTGGCTTTCTTTTCTGAACTAAActttcttggtctcattacgtatttcacattcaaa
attcaattcacgtgaccgttttgaacagctgaaaattgaacagcTGGGAGATCTGTTTTctttctggtctcattacgtatttcatgtgaccgttttgaac
agctgaagaattgctttgaacagcggaagcaaacatgtttcgagcaGTTGAAGCAAACAGCTGGAAAAATGAATGAAAGCGAAAAAAAGAGAATGAAAGA
GGACACTGAACgtcctaacagcagcgtagaccacgagcattagtatgggtacaatagtagtgataatagtactactatttacgatttattggctactatt
gaattggcgctacaagtgacaccaaacccagtactatagtaGTTctctggattttatccagagtccataggctgatgtcattcaggtgccattattggct
aatcacataccctgttgaatatgatctacaatgttgaagaactgtccgtgtttaatgcctgttacttcgaagtatcttgaatagcctgtttgttgtacaa
attatgctgctaagttgacccatccagtagagattgaaaataaataccggctcttctgcatagcctgtacgtaacgataatacctatgacaaatgattta
tctatttactcgagcattcgacttgaaagcggaaattgatctcaatatttttttatggtctaggtacatggacattattaactgtgcatgaacgctgagg
aagtgtttccatgtctatcctcaggcgagcaaaacttgacataattggcaaccgcatgccctttttccgaagtcggcactacagtcgtgctcgcctaaac
gttagcgaacagaagtatttacaaacaaacgtgtgtttagtaaatcagggatatttagaacatgttagttatcctcggttatatctaacttctggttgcc
attaccatgaactctgcaaacactattgaaatttataatagactaataactgtgcaacgtattgtctgcttgcagttccttcaaactatttgctcgagac
cactactttttcaagcatgaatcacatacacacgtactttaccaaccagtTGTCGtagcctagagagcatccagacacattctatcaatagttgcatgca
ctatgacgggtGGACACACCGTTTCAGgatcaaattgagaaaatctacaatcaaaactagaaaacctataatatcgctacgtgaacttccaaccagagag
ccagcagtaaccattaattttaaagttatgtcgtatttggggtttctatgcaacgccgatcgaagacaatacccaggatagcaaatccagtgttggtagt
ttctcgttttgaATATAGCTTttctcgttttgatcctacaaattctcaatttgaaatgttgtggttaccatcaatggcgcaccccttgccgacaggcctc
ggttgcttgactgacgaggcagtgcctgaacaatgtacccgtg