Description :
From Genome Similarity Track
Location :
Scaffold_2693:1157- 2646
Sequence
1489 bases(100 bases per row)
GTGGTACCGGAAACCTTACAACAGGATGTCCTACATCACTATCACGCTAGTTTGGAAGGTGGACATCAGGGGATTGGTCGGACCTACCAACGGATCCGGG
AATGTTTTCACTGGAGGGGGCTATTCAAGAGTGTGCAACGATATGTCGGTGAATGTGTGGATTGTGAGTCAGGTAAGGGAAGACCCGCAATCGAAGGGGG
GTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCACATCCCCTCATTACCGAAGTCATTCAAAGAAAACAAAGAGTTGTTG
ATTTGGGTGGATCTGTTTACCGGGTACGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCCGAATCGTACGAGGAGTGCGTTTTTCGAA
GATTTGGGGCTAGTGAGATGATTCGGCATGATCGGGAGCCAGGCTGTATGTCTGATTTCTTTCGAGCTTTCAACCGGATCCTGGGGCAGAGACAGCGAGC
AACCATGGCATATCGTCCCCAAGCCAATGGATCGGCCGAGCGCATGGTACAGACGATCACGAGGGCACTCAAGACGTATGTTCAGGATTTGGATCAGAGG
GATTGGGATGAGTACGCAGAACGACTCTCATTTGCAATGAACACCGCCCAGGACAGGATCCGGGGCGACACTCCATTTTACTTGGTACATGGGTGGGATG
CTAAATCTACCCTAGAAGCGGCCATTCCGGTATGTAGTACCAAGAAGAGAAACCGAGATCCCAGGCGATGGCGATACCAAGTCCAGAAATATTACCAGCA
AGCCAGATCCCAAGTGAACGACCGTCTACGAAGTGTGATACAGGATCGAGCGGATCGACACAAAGAAGGCGCCCGTCCCCATCAGATTCAAGTGGGATCG
CAGGTGTGGCTTTATTTAGATCGAGTGAAGGAAGGGTACGCCGCAAATTAGCCCGTTTATGGCACGGACCGTTCCGGGTAAGCGAAAAGATAGGAGAACA
TGCGGTGAAGTTGGAAACGGCAGGTACCGAATATCGCTTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAGGAATATCCGGACCAGCCGCAA
AACCCGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTCGATGAAGTCCTCCTACCAGAAGATAGTTGGAATGTGGATCTCGAGGACGACGAGTTCGAA
GTCGAGAAGATCACCAACACGAGGACAGGGAGCGAGCTAGATACGGACGGATCTACCGTGAGTTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTG
GGTAGACAAGGCAGATCTGAACTGTGGAGCATTACGCTATTTGCTTGCGAAATCGTACGAATCGGAACAGATTCGGCGTGATGCAGTCTCATGAAGACGA
GTAGGAAGGTGATCCATGGATGTGAGTTAGTCATGACGATGGGAGGATGAAGAAGGACCCACAGGAAGGGTGTGGGCCGGGAGGAGGAG