Description :
From Genome Similarity Track
Location :
Scaffold_6:1156929- 1164797
Sequence
7868 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTAAATTGGTCACTTCGCTCCCTTTCGGTAAAATGGGACCTGTGAACTACCGTTCACTGAGAGTTTG
TATACTCTCGAAAGCCAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCAACGCGGGTAAACTAC
CTGGACCTCTCCGAAGTTCGTTGCCATGGTTAGGAACGACTTCTCCCATCTGAACGACTCACACTTCGAGTCGGTTTGGAAGATGGCGGGCATCTTCGGA
ATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCCGAGCAGCTCGAGCGCGTCAATGCGTTTGACGCTTACGAGCAGGGGCTCATCGCGCATGTGC
GGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGTTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCT
TCACTTCTGGATCCGAGACGTAGAGCTCGCGATAGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGTGGCCGT
GCTAAGAGTTAGGTGTACACACGGGAAGCAACATTCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGAGAA
CTACGAGTACCTCCAGCGCTCGCGCTTCCTATCGTGCAAGCAAGGGAGGCGTGAGCTGCACGAGTACGTCCAAGAGATACAGGAGCTCACGGTGTCCCTA
GTGGGAAACCCACTCAGCGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTATGCCCAGAGCGCACTCAGCTGATCCGGGTGCAGTCAAGCA
CTCTTGAAGAGGCGATTCAAGTGGCTCTTCAGGAAGAATGCAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGAAGTTCTTTGTCGATCCC
GGTCGAGCGCAACGGACCCGTTCCCATGGAACTCGGATCCGCCGAGCAGTGTGACATTCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGAC
TACCCCGCGGAAAAACTCCGCAGACGAACTTTCCCCAAGCCCGTCCTCAAGGGTCACTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGAAACC
AGTAGTGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGAAGGATGCGCGGGTGGCGCGTACCACGGGGACTTCGTCCCTGAGAGTCTTCGCACT
CTCGAATCGGCGAAGAGCAGCGGTGAGTTGCTCGAAGTACACGGATGTGTACGGGAACACGATCACCCTTTAGAATCTTGTTCGATTCTGGGACGTCGAA
GAATTTCGCACGCCGCCAGACGGTTGCTCGTAATAGCAACAAGCTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCC
GACGGGAAGGTCGTCACAGTCCTCAACGTCCAAGTGGATCTGGCCGTCAACTTTGAAGACTTTGACAGCCTCGAACAGTCACTGTTTTTTTTTCTCGACA
TGGATCCATACCATATGATCCTGGGCATGCCCTGGCTTGAGGAAAACGTGCCCTGGATCGACTGGCTAGGCAAGGCAATTGGTGCTGGCCACCCTGCGAA
GTTCGACAGAGCATTGGTGGGTCATGTTCCCACCTCTGTCAGGATCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATTCGGCAGATGCTTGGGA
GTTGTCGACGTATATGACGACTCTGAGAACGCTTCGATGGCGGCGGCTCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCTCAAGCGGGTAACA
TAGGTCCGCAGACAGCTGCAGCTGTCACGAACGCTGGTAAAGCGTGATCAAGGTACACCACACACGGTCGCCCAGACCTTAACTGAAAGGGAAGACATCG
GATACGCTTCCTGTGTGGGTAACACAGTACCACACGAGGCCTCGAGTGCCTCGGATGTCGGCGCTCCCACATCCCCAGACGTGGGTAACAAAGTTCCACG
TCACGGTCACGGTCGCCGTCGACGACGACGCCGCCTCCGCCGAAAATCGGATCTGAACCTCGTTCAGATCGACGTCGCTTCAAGCGACTCGGGGTACAGT
GCCCGGGTTCCTCCGATAAGGCCGATGGAAGAGTGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCTTCTGGTGTCTACTTGGAACCGT
TGCCAGAGGTTGCAGAGATACTGAACCTCGAAGAAATGACGGTCGAGTCTTTCCTGGCCAACGTCAAGGCCGGAAAGGTTGCCGAGATGGTGCTCATAAG
ACCTGAGACCACTCGGGAGGAGCTGAACCCCTCCTCTGTCTTAGACGAGGACGTCCTGGAAGACCTGAACAAGCAGCGTCATACGCGCTTGGGTTCCGAG
ATCCTTAAGAGCCCCAAGGATCCTGTGTATCCTTTGGTGATGGAGTATGCGGGCGTGGTGAGCCAACATCCACCGAACCAACTATCACCAGATCGAGGCG
TACGGCATGAGATTAATCTCGTGCCTGGCACAAAGTACTGTGTCACGAGACAATGGCCTCTTCCGCGCGAACAATGCGAGGTCATTGATGCCTTCTTCGC
TACGAAAGCGAAGGCAGGCATGGTGCCGGAGTCGACATACAACACAGAACGTTGGCGTCTAGTTCATGCTTTTAACAAGCTGAACAACGCGACGGTGCCG
GCCCAGGCACCAATCCCACGAAAGGATGTGCTGTTAAACAACATGGTCGGAAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCC
TGATGCGCGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCCTGTCTAACGCCCCGGC
GACATTCAATCGCCTGGTGACGCAATTGTTCAGGCCACTGCGCGCCTTCGTACAGACGTACTTCGACGACATCTTCGTCCATAGCCGTGCCGAGGGAGGC
AAGACGACCATGGAGGTACATCTAGGACACCTCCTTCGAGTGTTGGACGTAATGCGAGCAAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGT
CACCAGAGATTAAAGTTCTCGGTCGCTTCGTAAGCAACGTGGGTGTTCGGGTCGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCAACGCCCCGATC
CCAGAAGGATCTTCGAAAATGGTTGGGCTTGGCCAGCTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGGACCTCCTTCAG
ACGGACGTCGACTGGCGCTGGGAACAAGAGCACCAGGATGCCTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGCCCTGGCCCTGCCGGACGAGA
CGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACTACGCCATCGGGTGTGCACTGCTGCAGGCCAACACGGCTGGACATGAACGAGTCATCTCGTTCCA
GTCCAGGCAGCTCAAATCCGCCAAACGGAACTACCCTGTCCACCACAAGGGGCTCTTGGCAATAAAGTATGCCCCTGTGAAGTTTCAGATTCACCTCCTG
GGCTCACGGCCCTTCGTGATCTACACCGACCACGCATCCTTGAGGACGGCGACAAATTTGCCTCACCTCTTTCAACGGATGGCGACGTGGCTGTCCTTCT
TCGCGGAGAACAGCTTCCGCGTCGAGTACAAGCAAGGCAAGCAAGCTCAACGTGCTTACGGACGCCCTCTCTCGGCGTCCAGATTACGAGTTGGCCCACA
TCACACGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGCGGCTGTCGCACCTATCGTCAAGCTCTTCGCGGCAGGAACGAG
CATGAAGTCCGACTGGCTTTCGTCGCGACAGCATTCCCGGCTCCACCGATATGAGATGAAGGATGGCCTCCTCTATTACCGGGCGGAGCCCAATGAACCT
CCACGGGTGGTCGTACCCAACGACGAGAATCTGGAGTTCGATATCTTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGCCACGAGAAGAATT
TCCTGTCGGTCTCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTGAATACATGTAAAACGTGTCAGCGCGTCAAACCCGCATG
GCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGC
AACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTCTCCAGTGCCCGTTACTATCACAGGCGAACAAACCGCGAGGTTGTTCGTC
GATGGCGTGTTCCGCTCTCACGGTCTCCCGTAGACGATTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAACGCTGTTTCCTTTACTGG
GAACTCGTCTGCAGATGTCCACTGCGGACCATCTATAGACAGACGGTCAGACAGAGCGCGCCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGC
GGAAGCACCACGTACGTGGTCGACGCATCTTCCAGTTCTTGAGTTTGCGCTCAACAACGCGGTACACGCATCCACAGGGTTCACGCCGTTCTACTTGAAC
GGCTTCCGTTACCCCAGAGTGCCTCTAACTCTTCGAGGAGACACTGACCCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCTAGGTCTCAGATGTTAG
ACCAGTTTCGCTGCGGAAACAAGTGGAATCCTTTGTGGATACCAAGCTGAGCGTTATCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCACGACAAACAA
AAGGAGTTCTATGACAAACATGGAAGGGGAAACTAAGTGCATTTAACGTGGGGACTTAGTGCTAATAGACACAAGGAACCTGCCGCTAGACACTGTCAGC
TCTGTCTGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGTCAGGCATGATGCGTCGTACACCATCCTGCCTAAGTCAATGACGA
CGCACCCGACGTTATATGTTGGACGTCTTTAACGGTACTTTGATTCGCAGGGGGTTGCTGACTCGCAGACCCACCTTGGCCCAGCTCCTCGAAGCGAGGG
CCAGTCACAGACGTCGACGAGGGCGTCGGAGCAGGTATTCAAGCCTCGGTCTGATCGGCAAGGCTGCGGTCAAGACCGTATGCAGGAGGGGCCCCTTACG
AACGGACCACGGCGCCATACGCCGGGTACGCCGAGTACGCCGGGTACGCGCCATATGCGGACGACTGGGAGTGCGCCGAAGGCGGCTCCGGACGTGGCAG
CAGAGCCTCGATACGTCGGACATGCGGAAGGCCTCGTCCAGATCGAGCGAAGAGGCCCGTCGGTCCACCCGCAGATGCAGGCTCGCGACCTCACGCTCCA
ACAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCCCCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCAC
GAGGACGCGTTGACGAAGGCGGTCAAAAAAAACCTCAAAACCCTGCGTCGGACCCGCAGGAGAAGCACTCGGACGAGTGTAGCGTTCGGGAGGCGCCGAG
TGTTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTACCACGTGGAGCGGATCTTCCAGGAGCAACGGCGTCGTGGT
AAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACGCGTGAAAGCCGATTGAACGGCTCCTGGCTGACTGCCGGAAGGCTGTTGCAA
TCTGGGAACAGAAGCGGCGGCAGCTTCACAAGTAGTCCGGGGCTTCTTGCCCATATGGGGTACGGACGTTGACGACACTCCGTAACCGCGCTCATCGTGA
GCGCTAGAAGCCGCGCGCTTCAGAATGTCCCTTGGCATCATGCGCTTGCTGACCAAGTGGGCGAACCGGACTCGAAGATCACGCTGGTCCAGGATGCGGG
ACAGCAGCTGACTTCATAGAGTTCCCGTAACTCCGAGGGTGAGTACTTGAGAGACTCCACCTAAGCCCAGAACATGTCCTTACAAGAGCTCCAGTTGGGA
CAGTTCTCGGGAAGAACTCAGGGGTAACCCCAAAGAGGGTAGAGACCACCCTGGTTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGAGGGATAC
GGTGTGGCGCGAGAAGCACACACCGAGCCGCCTCCAAGTTGTCAACAAACAACTGCTCCTTCTGGACAAGGGTACGTTCGTAATCGCTCGTGGAGGTGTG
GCCACCAACAAGACCACGAGGAGCGACGAGAAGGTCCAGGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCTAATACCCACTTGAGTTGATGGCAGCT
CCCTGGCTGACGGGTGCCACCACAGAACCCCCACGCGCGCGCTGGGCAGCTTGGAAGTCTTCCTGCTGCTGGTCGAGGTCGTTAGAGATCTCCCGGGGCT
CAAGAATAGCACCTTCTTTCTCCTCCTTCTCATCCTCTTCATCCGAGGAATCGAAGAGGCCCCGATGGGAGTACCCGTCTCCTTCTCCTCGCGGAGTGGA
GACTTAGAAGCCGTACGCTTCTTAGAGGGATTGGCGCCTTCGGCTTTAGCGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGTT
CTTCCTCCTCGTGGTCGCCAGATTGGGAGTGCCCTTAGCCTTGACGGCCGGACTCTTAGAGCGCACCGAAGTCCTGGGACTGTGATCACCTTGATCACTA
GCGGGCGACGGCATGCTGTCGTCCTTGTGCTTGCTGGGCACCATCCCGTAGAGCGCACAGGAGCATCGTGCGTGCTCCCGGGCTCTGCTTCGTCCTCACT
GCCTGAGTCGAACTCACGTTCAGCGAACTGAAGGTTCGGACGATTATCTGGGGAGGCCGAGGGTGATGTACTGCGGTGCTTGCTTGTACGCTTGCCCACA
GCCGCGCCATCAGTTGAGCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTGGAGTGCCGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCT
TTCCGGCAGCAGCCTTGGAGCGTGTCTTCGCACCACTTTTCGCAGTGCCACGGGGCATACTAGCAGTCGATGTGGAGACCAAGAAGAGGAGCGCTCAAAT
TGCTGCTCGTGGCTCTAATTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGTATTTTTTACTTTGAGAATGAAAGTTTGTGACGTACACT
TCTTCATTCTGCTTGGTCGGTAAACCGAGCCTAAGTGGGGGGGGGTGTAACGGGGTACGTAGCCCTAAGTGGACCCCTAGTTACATGAAGTGTGACACGT
CATACTTCGGGATATTTGGTACAAGGTACCAAGGTCGTCCAAGGCCAGCCATTGGCTAATGACATTGCTTTTCTATAGGTGACTTATATGTTGTATTTAA
CTCAAGCTTAGCCTACCTATAAATATACTCAGTTTACAATCTACCTTAAATTGGTCACTTCGCTCCCTTTCGGTAAAAGGGGACCTGTGAACTGCCGCTC
ACTGAGAGTTTGTATACTCTCGAAAGCCAACTTCCTCTAGCGCAAGGTGCTATGTAACCCCGTCACAT