Description :
From Genome Similarity Track
Location :
contig_11:11568- 13522
Transcript NameFunction/comments
g3170.t1hypothetical protein
g3171.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum

Sequence
1954 bases(100 bases per row)
TCACTGCAACGCAGTTCAGTGTGCTTCGGAGCAAGCTCGGGATCCAAGGTGCAATCGCTGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGCCTCGGGC
AGCTGCCGTATACCGGTAGGATACCGGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACGCTGATGATGGGACGCGGGACACTG
ATGATGGGACGCTGTTTACGCTACGAGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGTATCCACGTGGCAGTCGCTGATTGGCTGAA
GCAACTCAGTATCCGGTAAGGAATCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATC
AATCACTTTGCATTTTGCCATCAAGCGACCAAGCCTTTTGAGACGGCGGATCAAGATTCGTCGCAGTCGGATGAAGACGACAACGAAGAAGAGGAAGAAG
AGGAAGCTGCGCGGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCACGGACGCAGTCACTGGAGGAAGCCACGGAGGTTCCAAGTGCCAAGCGGTA
TGCATCGCAGAGTCGACACCAGACTCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCAAAAGGCTTGGTCGGTTGATGGCAAAAT
GCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCGGA
TACTGAGTTGCTTCAGCCAATCAGCGACTGCCACGTGGATACCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCTCGTAGCGTAAACAG
CGTCCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGT
ATACGGCAGCTGCCCGAGGCGCCTTCTTGACAACACTCCCACTCGACTCGACAGCGATTGCACCTTGGATCCCGAGCTTGCTCCGAAGCACACTGAACTG
CGTTGCAGTGATCGCGTTCGTCATCATGTCCGCCAGCATGTCCGTTGTCGAAACATACTGCAGCACCACTTGACCGTCTTCCACCTTCTCGCGCACGAAG
TGGTAGCGAATGTCGATGTGCTTGGTGCGCTTGTGGAACTGCGGGTTCTTGGCCAACGCGATGGAGCCTTGGTTGTCCTCGTAGATCTTGACCGCTTCAT
CGCTTGCCATCTCGCCGAGCTCGCACAGGAACACCTTGAGCCACACTGCCTCTTGTGTCGCCTCCGATAGCGCCATGTACTCTGCCTCCGTTGAAGACAG
CGCCACCGTCCGCTGCTTCTTGCTCCTCCAGCTGATGCATCCGCCGTTCATCATGAACGCGTAGCCGCTTGTGCTCCGTCGAGACTCGATGTCGCCGGCC
CAGTCCGCATCCGAATAGCCGCACATACCAAGGCTGTCTTCCCGTGAGAACTCGAGTCCATGCGTAGGCGTCGCTTGGAGGTACCGCAGCACACGCTTGA
GGGCTTGCCAATGCGTCGGACACGGGTCGGCAGAGAACTGGCTCAGCACTCCCACTGCAGCAGCCAGGTCCGGACGCGTTGCCACCATCAAGTACATGAG
AGCACCGACGGCACTCCGATACGGCACGTTCTTCATCGTGTCTTCATGCTGGCAGCCACCCTCACACATGTTCTTGGTCAGCTTGAGTCCGGGGTCTTGC
GGCGTCTTCACAGGCTTGCTGTCTTGCATGCCGAACTTGGTCAGGATGGACTTGAGAAACTTGGTCTGCCGCACCGTCACTTTTCCGGAGTCGCGGTCGT
TCTTGATCTCCATCCCGAGGAAGTACTCCAGCTCGCCGAGGTCCGTCATCTCAA