Description :
From Genome Similarity Track
Location :
Scaffold_48:115645- 118350
Sequence
2705 bases(100 bases per row)
CAAGTACGGAGGAGTCGAGAAAGACTCCCTGTTGTTATGGTTCGTCGAACTAGACAGAGCCATAAAGGCACGACGTATCGACGATGAGCAAATGAAACTC
ACATTTGCTCAAACTCACTTGGCGGGACGTGCCAAGACTTGGGCCTTAGGTTTGGAGATGAGCGACCCATATGCTTTTGGGTCGCTGGAAGCCTTTAAGA
CTCGACTCAAACATACGTTTGAGCCGCCACGGGCTGAGTTCAGGGCTCGATCAGAGCTTCTGAAGCTCAAGCAGGGTAAGCGTGATGTGCACGCTTACGC
TCAACATATACGACTCCTCGCGAGTAGTATAGTTTGATAACCCAGTACATGAACTCACGTTGATTACTGTGTTCATGTAAGGGCTCGTAGATGGGTCCGT
CAGGACCCACCTGTTTCGCTTAGAGTTGGATACGCTTGAACAAGCAATCTCAGCTGCGGAACAGGAGGACTTTAGCATGAGACAGGCTCATGCTAGCTCG
AGTTCTTATCGTCCACCGAGACGACAAGAGACTGGAGGTCCAGAACCAATGGACCTCTGTTATGTCGAGAGTGCGAGACCTCGCTATTCGAACAACAATC
GATTGCAGAAGTGCAATCGCTACCAGAAGTTGGGACACTACGCAAAGAGTGTAGTGCCCCACGCCCAGTACCAAACATTACAGAGCGAAATGATCGGCCA
TTTGTCAGAAAGGACAATGGGCGTAGGTCTAACACTGTTGTGAGACCGCAACAGCGAAGTGGACCATCAAAAAATGGTCGGGGTCAGTAGAGACGGAGCG
CCCTACTGATCCCGCAACAGCGAAGTGGACCATCAAAAAATGGTCGGGGTCAGTAGAGACGGAGCGCCCTACTGATCCAGCAAACTCAAGAGAATTTGCG
AATCTCTTGACGAAAGTTGATCTAGATACACAATCATTGTGTGTCTCCGCACCTGGTGATGAGATATCACTCATCACCTTGGAATTGAGAGTGACAAATG
ATTTGTCACTTCGTGCTCTAGTCGACTGTGGGGCGTCGAACAACTTTGTTCGTCGTCAGTCGCTAGAGGGTCGTAGGCTCAAGTTCGTTGAGCGCGACAT
GCCTCAAACGATGATGACAGTGGGCCTTGCCACAGGCGCGTCGATAATCGTTGAGAAACGTGTAGTTGGAATCCACTACAAGTCAGAGGGTGAACAGTAC
AATGATGATTTCATCGTACTGGATCTAGATGACAAATTTGATGTCATCCTGGGATTACCTTGGCTCAGAAGATACGAGCCAAAAGTGAGCTGGCAGCATC
GATCCGTGAAGATGACTGCCGCTTGTTCATCAGATGGCCATCTGATGAATGTCATGGAGCGTCCACAAGCGTGTGTATGTACTGCGAGTGAGTGCGATGG
CTTCACTTGCGGTAAGATCTTAGCACGACTGCACAGGACCTCAGTGTAGCTGATTCCTACACTGTGGAGCAAGCTTCCGGCGGCTGTACAGAAGTACAGG
CAGCGCCGAAGGTCTATCACTCGAATAAGTCGAGTGGACCGGGACATGGATACATGCCTAGCGGGCAACATCCTAGAAAGAAGAAACAGGTTGCCACCAA
AGGGCAACACGTTCATCCTAGGTCGACTGGAGAGTCGACCGTAGAGGATCGGTACCTGACTGTGGTTGCACAGCCACAGTCAGAAGACGTTGAGGGAATA
AGTCCCCACGTACTTGAGGAAAGGATTCCTCAAGAGTTATATGCTGAGAGAACAGGCTCTCAGCAATCTGAGAAAACGAGTTCCCAGGAAGAAACCGAGA
CATTGAATGTCTTGGTCAATGACGGATCAAGCGTAGGCGCTTATACGCTTGATCTGATTGTGCCTCCGAAGTTAACTTCGGAGATAACTCAATTGCCAAC
GCTGGAATCAAAACGGTTCCTGCGTGATCTGCGTAGTTGCAAGGTCAAGCAGATCTGCATACTCGTCACAGAGGACGAGTATGTGACCTATATTCGGTCG
GCAAGAGTATTTGCTGAGCACGAACGGGTTCTCAGCAGCTCATCGATGGACGGAAGTTTCCTCGATGAGAAGACTCGGATTGAGCTGTACACGTCTCAAT
CCTGGGAGTCGCTTCAAACAAATCCCTTATATAAGGATTTGATCGAATTCAAGGAAGTATTCCCTGAATCCGTACCATGCGAGTTGCCTAAGGACAAAGG
CACTCGTCATAAAATCAACCTGAAACCAGGTTCGAAATACTGTGTCATGAAGAAGGGGCCACTGCCTCATGAACAAGTACTTGCGATTGACAAATTCTTT
GCCGATCGCTTAGCAGCGAGCCACGTAAGGGAAACAACATCCCCTCACAGCTCTCCGAACTTCTGTGTGCGAAAGCCACGGGAGGGTGGCGGATAGTGCA
CTTATTCAACAAGTTGAATGCTGAAACGGTACCAGCACAAACGCCGATACCGAGGAAGGACGTAATTATTGATGGTAATTCAAAGAGTACCACCTTTTCG
TCCATGGATCTGATGGATGGCTTCTATCTATCAGATCCTGATGTGTGAACGAGACATCCCGTACACAGCAGTGAGCACCCCTAGAGGTATTATTCCACAA
GGGCTAAGTAATGCTCCTGCCACATTCAACAGATGCGTAACGAATCTATTGAGACTGGTGCGAATTGCCGCACTGAGTTACTTCGACGACGTGTTCGTCC
ATAGC