Description :
From Genome Similarity Track
Location :
Scaffold_20:115615- 123543
Transcript NameFunction/comments
Phyke_g1278hypothetical protein PHYSODRAFT_542020
Phyke_g1279hypothetical protein PHYSODRAFT_313255
Phyke_g1280hypothetical protein PHYSODRAFT_328767
Phyke_g1281hypothetical protein

Sequence
7928 bases(100 bases per row)
GGCTCGTACACATCGCCTACTGTGCCCAAAGGTTGCGCGGAGCTTCAGCACCGCCCCTGACGCCCCTAAACTCCGTGTGTGTGTGGTCGGATCTGGTCCC
GGGGGCTTCTATGCCACCAAGTACCTGCTCAAAGAGCACAATGGCGTGCGCGTGGACatgctggaggcgctgccCACGCCGTTCGGACTCGTTCGCTCTG
GAGTGGCCCCTGACCATCCGGAGGTGAAGAGTGTGATGAACGACTTTGATAAAGTGGCGGCTGACGAGCGTTTCCGCTTCCTGGGCAACGTGCGCGTCGG
CGAAGATGTGCGACTCGctgatctgcagcagcactaccacGCTGTTGTATTGGCCtatggcgctgctggagaccGAGAGCTGGGCGTCCCTGGTGAAGAT
CTGCGTGGAGTTATGTCAGCCCGCACGTTTGTCAACTGGTACAATGGCCACCCGGCCTTCCGCGACCTTGACTTGGACCTACAGGACGTGGAGACTGCGG
TGGTCATCGGCCAGGGCAACGTGGCAGTGGACTGTGCGCGGATTCTTACCAAGAACGTAGACGAGCTGGCATCTACAGACATTGCTACGCATGCGGTGGA
GGTGCTTCGACGCAGTGGtgtcaagaaggtgctgctcGTTGGACGTCGTGGAAGTGCGCAAGCGGCGTTCACAATGAAGGAGATCAGAGAGCTGACCAAG
CTGGACGGTGTGGCTTGTATTGTTGATCCAGAAGATATGAAGCGCAGTAAGACGCCCAGTTCGGAACTGGAGATCAAGGAGCAGCGCGCCCGAAAGCGCA
TGAACGATTTGCTGAGCAAGGCAGCGGAGCAATTCGATGCCACCAGCGACGCTGAGCGCGTTGTTCAGATGAAATTCTTAAGCTCACCTGCGGAGATTTT
GGCGGATGAGAAGGATGCAACACGAGTGGGGGCTATTCGTATCGAGAAAACTAGTCTGGAGGGCGAGCCAAACCAACAACGTGCGGTGGGCACCGGTGAA
TTTGAGGACATTCCTTGCAGTCTCGTGTTGCGTAGCATTGGTTACAAGTCGCTGCCTATAGAGGCGGATGCACCCTttgaccagcagcgtcatgtGGTAT
CGAATGAGCAAGGACGTGTTGTTGCGACGTCAGAGAGCGGCGAGACGGAGCCAGTCGTTGGTTTATACTGCACTGGGTGGGCGAAGCGTGGCCCGTCCGG
AATTATTGGCACAAACATTGTGGATGCACGAGAGACTGTAGGTTGCATCGTTGAGGACTTTGCATCCGGCAAATTTCTTCACACGAACGAAGAAAATTTG
GCCGGATTGGAGGCCATAGAGAAACTCATCAAAAAACGTAACCCAGACAAGCAACTTGTCAGGTGGACCGACTACGAGCGCCTCAACTTTGAGGAGAACC
GGCGCGGCGAACTAGTTGGAAAGCCTCGCGAAAAGATCACATCCGTGGCTGAGAtgcttgcagttgcaaaGAGCGTCAAGTGAGCCGGCCTGCCCGCCGC
TTGCCGTTTAGTATGGTGACAGTTGTAGGTTTTGAAGGCTAACTACAACAATACTGCAGGGGTTGTGACCACATGTATCTTAGTTAACTCCTAAGGTCCT
TGCGTTCTTGTTGGCGAGCAAGCGCGAGATTGGCAACTTTCAGCGCGTGTGTCTTCTTTCGCTGCATCCCCACGATCAAATTGCTGTCAACATGTATTTA
TCGCTGCAAAGTATGAAATACTACGCACCTCTTCTTCTAGCAGTCCCATCAGACGTCGGCATTCCACTGAGTCATCCGTCTTATCATCTTCATGACTCTC
CACCGACCCAGGATTCGATAAAGGTACCCTACTAGCGCTTTCGGGTCTTCTAGCGCTAATCGTTTGCTCGGGGTCCTTGGTAGTGAATGGATCACAAAGT
GATTGACTTACTTGGTCGCGAAGGGCAGTCGCATATGTCATGGGCTTGATTCTTCGTACAGGCGCTGAGACTGGCCGCGACAGTTTGTTTCTGTCAGACA
TCTTTGGCATTAAAGAAGTAGAGCGCTGGTTTTGCCTGTGCAAGGGAAGCCGCGCGGCTGCTGTTGCGATCTGTTCACTCACCACAATCCACAAGGTGTC
AAGGTTATGGCTGCCATCCACTTAGCAAAATTAATATGTTCTCGTACGACGGCTTTCAGGTGGCGCAGCTTTGTTGAATCCGCCAGGATATTTTTTGGCA
GCGAAATGGTTCTGGAGTATGGCAAAAGCGAGTTAACCATCAGGTTGACACACAATAGTAAGGGGGCAGTTCTTAGCATACCTTTGATTGTTATCCACGG
CACCTACTACCCGTCCGACATAGGTGTACAGCTCCAAGCAGTCGTCACGGATATTCTACGCAAACTCACAAGTACAGTCAGTAATGTACCCTTACATAaa
tgcaaaaaaaaaagaagaggTAAATAGCTGCAAGGTCAATGGCACGTTCACGCACATCCATAGAGTTCGCAGTggtgagctgcagctgctgcaatttgcc
ATTTGTGGCCATGAGCTCCTCCGTTTTGTTTTTCAAAACCTGTTCATACTGTTTGTATTACAGTGCGAATAAACAGTAAATGACACGGTGTCAAAGGCAG
CGTTAAATTGGGGTTTCCTTATGTTGAACGCACCTGCTGCCGAATGAGAGCGATTTCATTTTCCTTCGACCGCTGCAAGGCTGCAACTCGCTGAAGCAAT
CTCTGCGTGAAATGATATTACGTCAGCAACTCTCACAAAATGGCCGGTGCAGTAACGGGATTCAAACCTGATCAAGCTGTTCCTCGCGTTCCTTGGGAGG
TTCGCTTGCATACGTTTGCGCGTTAATGGTTGACGTTGAGCGCTGAAAATGCATTTGGCCATCCATGTTGGAGTACACCTGGTTGTTGCGACCGAGAAGG
TTCTGCATCTCTAACTGGTGCCTAGAAGCCTCAGCTGCCAACGCCCGCTCGTACTCACTGGACTTTTGCTCCATACAGTTTTTCAGCGAGGCAATCATTT
GTTTCTGTTCATTGATAATACGCCGTGCATTTTCCTTGTCTTGTTTTGCTTCAGTCTTGAAAGCGAGAAATGTAAGCTACAGAATTGAGTTCACGAAAGC
GTGTATAATTTGCTGTGAACTCACCACAACAACCGTGAAATTGTTTTTTGCGTTCGAATACTTCTGCCTTAGTCGATCGCGATCATTCCGAGCATTCTCC
GCTATTGTCAGCACAAATCAAGTGAGCTGGTCTTTACTCTTGGTATATTTGCCGTTTATCACGACAAAAGACACGCTTACCATTAGTTTTCAGCAAGTTT
TGAacgtgtggtgctggtcCATGCCTATTCTTAAGAAATGCACTGGAAGGAAGGGCACCGTTACTTTGATCTTCACTTGAAAACACTGATTTGAGCACTA
GGCCATCCTGCAGTACAGTACAAAAAAACATTAGCTTCACTTGGTAGTCCTCGTTGGGGTGAAAGGACAACGCACCGAAAATTTGATTTCGCCGTTATCG
GAGATCTCTTCCGCCTGGAACCCAAGCTCGTTCAGTGTTGCAACGAACTTATTATTGTATTCTGCGCGTAGGCCCTCCATTTGTCGCCGCAAGATACtca
gctcttcttggagctTCCGGATTCGCCGATCTTTATCTACGATTGTGCCATTAATGTGATTCACACGCGGCTACGCACGTCATGTTAGTGTTTGGCCTCA
TTTAAAGATTGAAAGTACTTCGTACTTGGTTCTGTACAGATCGGCAGCGGTTGGCAAACTGTAGTGTCCCTAAGCATTCTTCGTAGTGCTCTTTCATTGG
ATGGATAGTTGCAATAAGCGTCGTAAAGCAATTGCCTCCTGCAACCGAAGCAACCCAACAACAGTCCGTCAAAATATGAACTAGACCAGCAAGCAAGCAC
TAATAACAAACGAGCCTATGCTGTTCTGAAGAAGTCGGGTGAGCTTGGAGTCTCGGTACGGGATGTAGTTGTAACCACTCTCTGGGTCCAGCGACATCAC
CACTTTGCCTACTGCGCTTAAGCTGGAATTAATGTGCAACGCCTCCTTAAGTCGCTGGCCGTCGGACTCGCTTTTCTTCAATCGCTCGGACCTAGATTCC
GCGGGTCCACACTGTTAGGAACGGGCGGCAAGCATAACTACTTGCTATGCCAGAAGTTTGGTCAGGAAAATAGTACAATTGAAGTCGTACCCAGCAAGGT
CAACCATGTTGAGCATCCCGTAGATCACTTCATCAGTATCACGAACTGCACACATTTAATTAAAAGCCAAAAAAGGCAGTAAAACAGTCAGTGATTACGA
CCAATATGGTATTCAGCAGACTAGCTTCATCAGCATACCTCGCTGAAAAACATGAATCGTGAATACAGTGTGCGAACGCGAGGATACGGCATTCATTTTT
GTTTCGTGGGTGGATCGAAGCTTCAACCCACACTGAACGAtagcatctgcttcttctcggGATGATACTGTGATCATGGATAGATCTTTCACGAAAACTC
TGCCTTGGGCATCCTCGTGGATCTCAAAGTTTGCTGCGAACGTAACATCCGAAGCCTCAATAGCATTAGCGTGGTTCAATGTGAACTTTAACGGAATGCG
AACCAGCTATCGTGTTCGGACCAACCTTTCTCGTAGTCATAGTCCTCTTCTGCTTTAGGTGGAATTGAGCTGAAGCTATTGTCGGGGAAATGCACGTAGG
TGATTGTAAGTAAGACATGAAGAGCAACGCCCATGCAAACAGTGCACCTCGTAGCGCTCTCGGTTCGAggaatctgctgctgctgttgttgttgctgctg
ttgctgctatccAGAGAAGCATGCGTCAGAGATGCCAACGCCACAACTGACTCAGGTAGAACTCACTTGTCGGAAAAACCACTCGGCACTACTTGACGTT
TGGTACGAGACTGGCCGGCCTGTTTTCTTGAGGTAGCTGCATACCCATTAGTGACAAGTAAACACACGTATAGGGAGAGAATATGAATCGCTACACTTCA
TCACTTACGCTCGGGCAAGGTCGCGAACACGATCGCAGTAAATTTCCAGAAAGCTCACGACAAGAGTTACCTCCTGGTCGTCAAGAAGTCGCATGAGAAT
GTGTCTGAGAGAGGTTGAATAAGCGGGTAGTATGCGTATGTATGGTAATATGTAGGGGCTTCACGTGCCTTGGACTTGCTCGCTTGGCGCTGGATCATGT
CAAAGAGATATTCAATCGACCGCGATAGCAAGCCCACTTTCTCCCCTCCTGGTTCACCGAAGATACTGCACAGGTAGCGATGTATTTGATCAGTGCTGAG
AGCAGActgaaaatgctgttggTCATAATTTAGTACCTGAACGTTTTGCCTGACCCAGTTTGCCCATAGGCAAAGCAACAACTGTTGATGCCTTTCAATG
CGTAGTCCACTAGACATTTGCTTGTCTAACACAGTGGATAACGACAACGTGCAAGCACTGTCAGTCTGAGATTTTGACACGATACAATCAGCATCACATG
GAATACCGATTCAAACAATGTATCTTGGGTCGTGTCGGTCCAATAGACCTGCCATCAGCCGCAGGAATCGCATGACATAAAGGTGAGTGTAGCAGTCTCT
ATCTTGGCAGCAGAGCTAAGCCAGATCGCACGTGGTCAAAACTGAAGGCGTGATTCCCATATTGCATTCGTTCAGTGTCCTAAGGCAGAAACAACGAAAC
AGAGTGATGTGCGATGTAAGCATTGTATTGTAAACTCATCGAAACAGGAGCCTGCTTCTATGATGTCGCACCTTAATCACGATATTACTTGGAGTTTCTT
TCTTCCGCTCGAACATGTCCTCAGGAGCCTGTTGTCCATCAGCACAGGGTCTTGCACGAACATACACCTACAAGACAAAACGGAGTACCTTCAGATATGT
AGACCACCCCTCATGTCTTTGAGAATCCAAGAACCAACCTTGACATTTGCGTTACCAAGCAGCCGGGTGTAGTCGGTCGTAACCTTGTGGTCCATGGTGG
AAAAAGGCTGATCCCTCCTCCTAAATCTTGACGACAATCGTTCTCAACCTTGCTTCGGGTAGGAGTATTTCAGGTTATACGTTTCGAGTTACCGTGCTCG
TAGCGACTGTTCACTTTTTGCTTTGCCGAACACCATTGCAGTGATGAAGCCCATCGATAACACCATGCCTACCAATTCGATTGACTATTTGCACGACGTG
CTTGGGCACATCCGTAATCTTATTGTCCGGGCTTCTGCCAGAGGCAATCCCAGTAAGCACCAGCAGATTCGGGTCGAACACTGGGTGCGAAAGCTGCGCA
GTCAGCCCACTTCCAACCCCACGTGGCTGAAGAGCGTATTAGAATACGCGAACATGCTGCTTCAAATGCTGCTAGAAGATGTACGCCCTATAGCCTCGAC
CTCTGTACCTAGCGTCCAAGTGTGCTGACAAATATATTGCGTACCAGGCAATCGACGAGCCGTTCACGAAAATGCCACCTCAAGGTccattgccagcact
tcCACGGCACCAGGTAAGTGGCACAGCACTGCCCACCAATATCTCAACTTTTTTATTTTCATCAACTCCAGATCATTGAGTGCTTTGTGCCGCGCTGTGG
GCCCACACATTAACCAGGTAGCGAGACTGGCAAAGACTGCCAGGCATTTTGTCAAAGCGTCGGCATTTCGAGCCAAACGTTATCAATCCAGTGCACGTCC
CGGCTTGACTAGACAATCACTAGGCAACAATAATTTAGAGGAGGaacagccaccaccaccacccgtAACTGAAGTTCAGAAGGCGAGCAAACAGATCCAA
ACACAGGAGCAAGATGATCAATGGGAATGGCAGCGCGTCTGGAAGGGAGCCTTCGCCAAGATGCAACACCAACTGCAGGACAAAACGACGGAAGCGGACA
CGCTGGTCACGGAGAATAAGGTGTGGCTCTCCAGGTGTCAAGTCTTGGTATCTACCTGGTACATTGTCTCTGCTTCTAACTTCGAATCGGGATCCCTCCA
CTTGTGTTATTTTGTAGGAACTTCGAGCTCTATTGGCAGCACACAAGAAAGCGCTGGAAGATGCCGAACGGGACCGACGTGATATGCAGACGAAGCACGT
CGCAGAACTTGAGAACCTGCGAGCAGTTCACTCCCTGGAGCTGGTAGATCTCCAAGCCAGACACCGTCAAAAGCTCCAGGAGATGCGGCTGCAGAACGAC
GATCGTCTGTTTAGTAGACGTCGTGATAATCATTTTTTGCAGTCAGTATCGGATACAGCTCTTAATTGTGTAGAGCCCCGTCAAACCCTCTCTGCTCCGG
ATGCCAACGCTGACTTCCTGCAGTACATTGACGCGTTCTACTCAGCTACATTGCAATTGACATCGCAAAACAAGCTCTGAAGGCGTTCAGTATACAAAGA
TCAATATATTTGTGTTACAATAATAGTAACCCATCCAAACTTTGTGCCACGCACATCAATCAAGAGACAAAGTATGTCGAGCAAGACTCTTCTGCAAGGC
GATCCGCGTCGCCCAGGCGACTTACACCCGTTCGTGCGCGAGCAGGTGGACCCCGATGATGCCCCAGGAGACTGGTacgccttcttctcgctcgtCCTGG
GCTTCCTGGCCTTCACCATGAAGGTATGACGTCAGTAGCATAGACACATTTTATCTCGGCTTCTATCCCCTGAAGTTTGTACGCCCAATTTTGACGCAAA
TCTCTGTGTATTGATTCTGTTTGTAATAATCAGTGGAAGGAAATGGCGTGGggatcgctgctgctgtgcgttgGATCGTTCGTCAACATGAAGGCGGAGG
ACATGAACACGACGCAGATCGCCAtgtctttcttcttctccaccagtgcGCTTGTGTCTTCTTACATGGGAACTATGCGTCCAGGGATGCCCATGCCACC
ATCAGCCCAATCTTCCCCTGCACCATAG