Description :
From Genome Similarity Track
Location :
Scaffold_527:11561- 13516
Transcript NameFunction/comments
g13670.t1hypothetical protein

Sequence
1955 bases(100 bases per row)
GAAGTTCCTCTTCATCTGCCTGTTGCAGAGGCAATAGTTGCGTGTCAAAAGTGGTGTCCAGGGGTCCCGCCGTTCTCGCCATTTGTGGGGGCCTGTCTTC
CAATGCAAAAATGACGTTGAACATGGTCGTCTCGTTCCCCGTTGTGGCAGTAGAGCCGTTCGTCGATTGCTCTACTACTGTAGTGGACACTCCAGAAGCC
GATGTTGAGCCATTTCCGCCATTTCCCGGGCCGTCCGCTGGTGCCACAGCCGGCAGCCGACGCGACACTAACACAGGGTGACTCACGAAGCGCAGATCGT
CCACCACGAGCTCGAAACTGGCGTTGCAGAGCGCATTCTTAGGCCGGAAGAGTTTGGCCAACAGAGGGGCCGGCAGCGAGTGGAAACTGGACACGTTCTC
GGACGGAGATGCTGGGTATCGGAACGCCAAATTGCAGCCCTTGCTGATGTCGTCCACGACCAGCGCAACGCCCAAGAGGCGGCAGCCACCGGCCACGCGG
AAGCCCCAAGTGTTCATATGCTGGAGATCTTGAAAATGCGCTTATACCTAATTGACAGTTGAGTAGCAGATATAAACTGCTGGTAAAATGTAAAGCGTAC
ATGACGCAATGCTGGTAAAGTGTATAGACAACTTCAACATAAAAAGATGGCTACATTTTACATTTTGAATGGTACACGTGGTAGTAGGTGTAGTATGAGG
CGTGTGGGCTGGGGCTGGTTGGGGACGACGTCCTGGTCGCGAGTGCAGTAGGCAAGGCTTTGTGTGCAGAGCGTCTGCAGCATGAGACGAGTGTTGCTAA
CGCTCTCTTTGGACGGGAAACAGGCGCTTTGCAGAACGACTTGGCCTCCGTTGGAAAGTTGGTGGCGGATTCGACGCAGGACCTCGTCTCGGTATGCTGC
GTTAGTCACCACTTCGTCCACAGGCAGATCGATCAGCTGAAGCTCTTGCTCGAACTCGTTTTGTGGGGAGACGGCTGCCTCCTCGTGTTCAACTTCCACT
TCAGTGACCTTCTCACCGTGTGATTCCGCTGCGGTGGACTGCTGGTTCTGTGCCTTGCTTTTCGATAGCTGGTCTCTCCACTGCGGTCCTCTCCGCAGCT
CCAGGATTCTCTCTCGCTTTCGAATTGCGTTCGTTGTTTCGCGCGCTTCTTGGTCCCGAGCACGGGCTCGATACGCGTGCTTCACCTGGCCGACAGTCTG
GGGAAGTTTTTCATCTCGTTCGTGACTTTGAAGGCCTTCGTGGTCGATTTCAATACTGCGCCATGTTCCAGTTGGCTGACTTTCGTACGCGGACGCTCCA
AGTGGCGTACCAAACAATGAACGCAAACTGCCGGCGCTGGTCATTCGCTCGGAATCCGTTGCTCCACCATATAAAGATGGGGTAGAATCACTGGACGTCA
CTTGTGTAGCATGCCAGCTCTTCACCAAACGCTTCTTCTCAAACCTAGATAAATGCTGCAGCTCTTCCGCCATGTCTGTCGATCGAAATGAGAGAGGATG
CGACCACAAAAGGCGGTTATTTATACGGCACCACGATCTTAGCTAAGCTCGATGAAGCGACGTACAGTCTCCAAGACCAGAAGCGCTGACTCTCGAGCAA
GTCGTCTCGGGTCTTCGTTGCGTGGTGGCATCTCGTCCAAGACTGCTCCATGCCCAGCGAAGAAGTTGGCGAAAAAGCAGGTGTCGAAGAGTGCAGCAGC
ATCCATTTTGGGTCTGAAGAAGAGCAGTTCATCTCCAGAAGGCAGTGCTACCGATAGGTGGAGTAGTGATGAGAGTAGTACGATCGACCACGTGGGCGAG
TGTAAGCGTCTTCGTGAGCAGCTTGAGAGAGTGCTGGTGGATCACCAAAGACAAGAGGAGGAGATCGTGGCACTAAGAGCGCTGGCCAAGTCATTGAAAG
AAGAAGTGGAAACGATTCACGAGCGGCAACAACTTCAAAGCTCTGGAGGCAATAG