Description :
From Genome Similarity Track
Location :
Scaffold_229:11556- 19856
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_229-snap-gene-0.14Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_229-snap-gene-0.15GG20274
Pytul_var.sporangiiferummaker-pug3_contig_229-snap-gene-0.20Kinesin

Sequence
8300 bases(100 bases per row)
TCTTGTCTCAATTGGCGACGAAACTCGAAACGGATGCGACTCAAGAAGCCGATGAGTTTGCGTGTTTTGCACGAGAGAAAGCAGCGTTCAATGGCGTGCA
CCATGAGCAGCAGCAGCAAGGCAGTAGTTCGCCCAAGAAAGCTTCAGCGGTGTCTTCAAGCAACCAGAACGAGGCGACTGGCAATGATGGGGACGACAAG
TATCACCGTGTACACCTGTGGCTGCGCGATGCTGCCAATATGCTCAGCGCGTCACACGAAGTGAGCGCGACGTTTTCGTTTGCGAACCTGAACGACATGC
TGCTAGGGAACCGCTGGATCGCGAGTGTGCTCCCGTCAAAGCTGTACAGGCGCGTGAAACATGTGCTCACGACGCCAGGCGGCGTTGCAGCCGAATGGAA
AAGCGGATGCGATTCATTCCGATCCGAGTTTGCATCTGCGCGTCACTTCCAGGGAAGCAGTGACGCTGGTGGAGGGAGTCGGACCTGGTCCCGAGCGTCA
TCACGGTCGTCCGCCCAGCTCACAGACGATTTCAACGCCATTAGTGGTTTGGAGCACTCTATTGCCAGCGCATTTCCGTTCGCAACGCCGGCGTCGACGT
CGGAAGCTTTGAAGCGCTCCGTTAATCCCACGAGTAACAACGGCGCACGCGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGCAGCATGGAGCAGACGAACCGGGTGAAAAGAAAGCGGAATCGTTGACGAAAGACGAGATCGCGGAGCACGAGCTGCTGGAATTGTACGACATGTGC
GCGAAGCACCTGATGGGCGTGAACGTGATCCGCGCCGAGGCCGGGACCAGTGGCATCACGTGCGTGCTCGAAGGATGGAACTTTTTCAACCTCTTACCAC
GCGTGCAGAGCCATTTGGTCAAGCGACAATCGATAGTGCGTACAAGGAGCTCCGCGTAGGTTACGTCCAACAGCGGCGCGCGCTGGTCGTAGGATCAAGA
CATTTCAAGAGCCAATTGACTCTTGCAAGCAAAGACGTTCATGTCATAATGATTTTATTCATTTTCCTTTGGGCCATAGGACCTCATCAATGATGGGCTG
GCACGTAAATGACATTCGCTACAGAGGTGTCTCACATTGCATACGCTACACAGCACTCTATTATGAAAGAAATGAACGCATGCATGTGACGGTGGATGGT
CAGTGTAACTATGACAAAATGTAAAGCTCACAGAAGCGCCTTCAGACCATAACGGCTGCATGACGCTTTCACGGATTACGTATAATTATCTTCATTCCGT
CCACATCAATAACAGATAAATACACACACACAAAGCAGATGCACGCTCACTAACTATTGACGAGTGTGCATGGACCACAGAGCTGTCAATCGAGACGGTA
GCAAATGCACCGCTTGCTTTCCGCCTCCAACGCCTTTGCGTCAATGAGCCAAGTTGGCTCAGCCAACAGCAATGCGCGATTCCTGCAAGAAAGTGTAACC
CCGCACTTCCTCCTACCAACCAACCAACCAACCATCTGTTTAACCACTAAGTTAATAAAACATATATGTATTAAACACCTTTGCGTTTTGGTGCCAAACC
CTCTTGACCCGTGCGTCCAGACCCGCCAATCACTAGACCCGATCTTGTTCAATGAGTGCTGTCCCATGCTGTTTGAGAGGTTTTCCTGCGGCTGCCACGC
AGGCTCCAAACTGCCTACATCTTGAGACGCGAAAATGGCCGTGCGCGCCGTGCTGCTGGNNNNNNNNNNGCGACCTCCAGCGCGTGCTCAGCGTCGCCAG
GCGCCGCTACGGGCTGCTGCTCAGCAAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGTGTTGCTATAGCACTTCGCTGTGTGGCAG
GCCGCGAAGATGACGCGACAGAGGTATTAAAGTCGAGCTTTGTTCTAATGTTACGTATGGTGTACTGCGGTGCGAGCTAGGATGGGGAGTTGGCCATTTT
CCAGAACTTCCAGTTGATCCGCGCGCGCGTGCAGCGCTGCGAGAGTACGTCTCTTCATTGCTGTTGCTCTTCGCTCTTTCGCTCTTTTTCTCGGAATGTT
TGGACTGAAGGCCGTCGTCGATGCATGCTGATGCTTGTCTGTGTGAATGTGCGCAGATCTCGCCGAGTTGAACCCCGCGATTATACTCCGACCGTTTCTC
GATCTGATTCGCCATGAGCGCACGAGCAGCACCCTCACTGGCGCGACGCTGGAGGTTGTGCGCAATTTCCTCATGGTGTGGCCCTGGTCACAGGTGAGAG
ACGCGGACGCGGTCGCCGACGCGGTGTCCGACATTGTGGACGCAGTGAGCCAATGCCGCTTTCAGGAGACGAACGCGGAAAGCGACCAAAACGTGATTGT
GATGGTCGTGGATGTGCTGCATGCGATGGTGTTGTCGCAAGCGGCCCCCTACCTCTCGGACCACTCGATGTGGCAGCTCGTGGAATCGCTCTATGCGCTC
AGCCGAGCGCATCGCAACGATGTAAGTGTTGTTATTAATTTTTTCCATGCGTCTTATGCCTAATCTCATGATTGCTGCCTGCTATAAAAACCTGGGCATC
ACTAGCCGCATATCACGCTAGCGCTGCGCTCAGCCGCGACCAACTCGCTGCACGATGCCATCAAGTTCATCTTTACGAGCTCCTCAGTGTACGCGGATTC
GTCCGCAAAGTCACCCGGGTTCGGCTTGCCGTGCGCTGTGAAGATCGTTGGCTTTTTCTGCCAGAAGCTCCACCAGCGCAGCGCAGGAACTTCTGTTGCA
TCGAATCGACGCGAAGTACTGCTGGCGCTCGGTCTCTTACATACAGCACTGCTGTCGTGCGATGCGCAGCAGATCACGCAAGTCCCTTCGCTCATGTTAT
TTATCAAGGACGACCTGTGCAGTGGACTGCTTCGATTCTGCCGCCTGGGGTAAAGTTTGTTTTAGATGTCGCTGAGTTGTTGCCAAAGACGATCCTCACT
CCTGCCTGCTTCACTTTCTATAGGGCGTCATCTGATACGAAGATTCCAGTCCTTTGTCTCGAGATCATTCGCTTGCTGTGGTCCAAGCTTCGGTCGGTAC
TGAAAATGCAGATGGAAGCGATCTTCAACGGCATGTTTGGCCACACACTGCACTGGACGATCGCGCATTTGGACGTCACGAGTCCAAACTTCCCAAGCGA
TGTCAGCAGTAAAACAAATAGTGCGACTCGGACTAGAGGAATTGCAAGCGATGCCAAGTCCAGACAAGGTGTCGAAGCTGCAACTGAGGAGTTTACGGGT
GAAATGACCTCGACGTCCCGCCTGTTTGCTACATCTTTTGAGATTCTCGACTGCCTTGTGGATTTGCTCTCAGAAGCAACGCTCCTACCGGATCTCTACG
TAAACTACGACTGTGACGGCAACCGCTCCGATTTGACGCAGAATATTTTCGAGTTGCTGTCGCAAGTTGTTCAATATTCTCATAACGCTTGCCGGGAAAC
TCGTGGAGAGGAACACTTTTTGTGGGCTCAGGGGATCGGAGAACTTGCACTGCGTGGTCTCTTCAACGCGCTGTATGTGGTGTACTTGCGAACTCAGCAC
AAGCAGTCAAAGCCATACTCAGCAAGTCAGCGGCCCAGTGGAGTCAGCATATCGAGCGAAGACGATAGCAACGATGATGCACTTCTTGAAGAGAATCCTA
CGTCCCCTCGTGATAGCGTGGGGTACGCGACTGCTGAAGTTTTGTACAAAAAGCGTCAGCGCAAGAAGTTCTTTCAGCATGGCATTCAAGAGTTCAACCG
CAAACCAATCGCAGGAATCAAGTACCTACAGCAGAATACGTTCCTCCCGACTCCGCTGGACTCCAAATCACTCGCTGCTTTTATGCGCTCGCTTCCTCCG
GGCTTAAACAAGAATGCAGTCGGAGCGTACCTTGGTGCAATGGGTAAAGATGTGAAGGAGTTTGAGAAAGCAGAGATACATGAAGCTGACACCATGGATT
TCCATCGAGATGTGCTCGCTGATTTCGTGAAGTCGTTCAACTTCGAGGGTGAAAATATCGTCGCGGCACTTCGAATGTTTCTTGCGAGCTTTCGACTTCC
AGGGGAGGCCCAGCAAATCGATCGTATCTTGAACACGTTCTCGCTTCAAGTGTACGAACAATGCCGCGATCGATTCCTGATGGTGTCCGCCGATGTTGCT
TACCTGCTCTCGTTCAGCTTGATCATGTTGAATACGGATCTACACAATCCAAACATTCGTCCAGAGAAAAAGATGAAGCTCGAGGATTTCATCAAAAACA
ACAAAAACTATGGCAAAGAAGTGTCGAACGGCCGTGACCTTCCGGACGATTTCCTGACTGAGCTTTACTATACGATCGCAAACAATGAAATCAAGACTTT
CGAAGATGGAGGGAAACACGGAGAAGTGACGAACGATCGCTGGAAGGATTTGCTAAACCAGGCAGAGAATGACCCAAGGAATTCTCGGCTCATTATGCAC
CATCCACCGCACCAGGCAAGCCTATACACACCGCTGACAGTAATTACCGTTGATTCTAGTCGGGTAAACAGTCAGCATCCTCCTCACCACCTGAACCGGA
AAAGCAAGCGAACGACTTCGAAATCTTCCGATGAAGCGCGACTGCGAGCTCACTCAGGCTCCTTGTACGAGGAAGAGTATGGCGTCGCTGATGAAGACGA
ACACGTGCCTGAGAGTAAACTCCACCTGTACATCAACTACTCTGCAAGTGATCAATACGATCGCCATATTTTCGAGTTGATTCAGCAGCAATTGGTTCGA
GCATTTTGCAGTGTCTTCCAGCAATTTACTGGTGTATTGAACGACAAGAATGGGGAGACAAGACCTGGCAGCTCGTCGTTCTCCGATGGTATGTCAAGCG
AAAGCGCATATTACGTGCCAGAAAAGAGCATGCTTCAACTAGCCTGCAACGGACTCGTGCTTTGTGCTGCTGCAGCGTCACACTTGACACTGCATGAACA
TTTCAACGCCATCTTTGTTCGGCTGTGCAAGTTTACTGCGCTGCTTTCGTCAGACATGTATCCTTTGGCCTACAACGGACTTGAAGAAGGGGTATGGCTG
TTTTGCAGCAACCAGAGTGCACCTGTGGCGACAGCAGGTATTTTGAAGTTGGTTCACACTTGCAGCCTTTCACTGAGCAGTGACTCATGGGGATACTTCT
TCCATGCAATAAGTGCATTAAGAGAATTCCAAGCGCTGCCCTCTCGCCTCTTGAATTCTAGCAACACGAAGCTGAATCAAGACGAATTGGTCGAGTTTAT
TGAGCTGGTGTACGAGAACAAGGAAGAGCTCCAGCGAAGAGAGGCGTTGAACAATGAAGACTTGTCTTCTAGCTCCGGAGGCGGTGGGTTCCTCAGTGGG
ATGGCGTGGCTGATGTCGGCATTTGATACAACTCTCAGCTCGTCCATGAACGTGTCTGCTTTGGAGTCATCCGAGTATTTGCTTGAAAATGACACTCCAT
CCAACCCTGCTGATTTGGCAGAGCATGCACAAGATCTTGTCGTGGGAGTAGATTCGAGGAGAGATGAGACCACCTTTCAAGACGACGAAGCTGAATTTGG
TACGGAGGAATGGATTCGTTTGACGCTAGCGCCTTACAGATTGGAGTTTCTGCTACAAGATCTGTCCAGCTTACCGACTCGAGCACTCGTGGAAGTTGTC
AAAGCTCTTCATGAGGAGGTAGTCCGGACGTTGACTGGAATGCCCAAAAATGCACCACAGCAAGCCAGCAAAAGCAAATCGACCCGAAAGTTGAAATCTG
GACATAAGCACGCGGAGACTGCCGACAAGAAGACTGCGACTTCTCTCTTCTTGAGTTCTGCGGGATGCGTTTTGTTTGAACATTTACTCACCCAGATCAT
TTCGCTGAGTGACTCCGTTTGTGATGGCGATGCCGATGATGAAGAAGGAATTTTGAAGATCTTGGACGCTCACTATGTGCAGCTGCTCGAACTGGCACGC
CCGATCTTGTCAAGCACTTCAAGCTCGCAAAGAATCTCGTACGAAAACACTTGCTTTCTGTTACAGAAAGCAATCGATGGCGTATTTGCTTTGGCAATGA
AGACGCCAAACGAACGAAATAGCGCGTTTGTTTTGAATTTCGTGGGGACTCTCGTTGATATCAGTGGTGATGAGGAACTTATTCGACCATTCCTTTGTCA
GATACTGTCGGGATTGGAGAACTTCTTTACCACTGCCACCCTCAGCACACTCCAATATTCTCGAGAGCAGTGGCTGATCGTGACGAATTTGATCAGCTGG
TCCGTGGAAGTTTCAGGCGCGTCAAACCATGGATTTGGGCTTCTTGAATATCTCGTGACCTCGCAAGTGTGGAATGTTGAGGGGAGTGAAGTGTCGGTTA
GTGATTGCTACACGAAAATGCTGATGTTTGCGTTGGCAACGCCGTCGAAGAAGGTGAATTGGAGTCTGAAGCGAACGATGGAACTCATGCACTCAATCTT
CACAGCTCTTATCTTGGAGGCGCCCAATGATGTTGAAGATCTCTCTTTGCGTTTTCTTGGTGGGATGGTCCTGGTGTGCCGACAGCACGTCAAGAGCCGT
GATGTTAACGCAAATTCCAGTGCCTCGAACGCATCGAATGAAATCATTACCCATGGACTCGCATTCGTGGAGCAAATGCTTGGCTCCAATCGCCACAAGA
AAGACCTCTTCTCTGCTTCATCGTGGTTGGAGATTTTGCAGCACGGACTTGTTCCACTCGGCTATGACATCCTGAACGGAAGTGCATCAGGATTGACAGA
TCGAATGATGGAGGCAAGTGCTTCTGGAATAACATCGCGCGTGTTGTACTACCAGCAGCAGCTTCCACTTCACAAACGTCAAGACCAGGAAGTCCACAAG
CAGAACAAATCATCATCAGCGAGAAGACGCCGGCCTTCTCTTGTCAAAGATCCGTTGGCGTTGCGTCCTCACGTCCTTATGGTGCAGTTGATTTCTGGAA
TAGTCTGTGAGGAATTGAGTCAACTGTCCCAGTGCGAAGTCTTCCAAAGTGTGTGGGACGAGCTCGTCGGTCTTCTCATTGGTCTTCTTCGACAGACAGA
AATTGGGAGCGGCGATGGCGACGGTGAAATTGCGATTGCAGCGCTGGAGCGTCGTAGTGTCTTGTCAGCTCACGAAGAGATCTTGGAGCATGTAAAGGGA
ATCGCGCGGCGGCTTTCTGCTCTGCAAGACGGAAGCGATGTGAATCGAACTCTAGTGGAAGAGGAGACAAAGCAAGAGACTCCATCGGGCAGTGAGCCAA
GTCTCTCACAGCTTTACTCTGCGTTGGTGCACACTCTCGTTGAAAAATGCCAACCGATCCCAGGACTGACCGAGCAACTGTTTCCTGCGAAAGATGACTC
TGGATCGTCCGAGGATGAAGAGCCGACGGGAGCCAATGCTGCGAATGAAGTGACTGAGAGCTGACCAGGTGCTTAATATTGTTAAGAAGACATATTCATT
TAATTTTAATTAAATGAATTAAAATATGTAGAAAAAGAATAAAAGAATGCTAAAGCTTCACATTTGCTCGTAACTCTGGGCGTACTTGTCTACGAGCAGA
AGACCAACATGGTAGTCTGGGATTACAGGTCAGCTATGATTTCACACCAGGCTTCTTGTTGTTGTTGCTGTTCTGATTCGAGTCGAGAAGACTATCGGCA
ACCTCATCGACCTTCGCATAAGCACCGCGAAGCTTTTCAGAAAAGCACTGTGTAAACATCTGCGTCACCTTGTCAATCACCACGTCCTTCAAGTTGACTT
CATTTTGCTCGATTGCCATATCGCAAAGCTTCTCTGCCACTTCGACTAACAAAGTGAGCTAAAAGAGTACACCAACACAGACTTAGAATCGTTCCTTTCC
ATTTCGACATAAAATAATCAAAGTACGTACCCGTTGATTGACCTGAGCGATGCTTTCCTCAGCCTTTTTCGCTCCTTGAGTGGGTGACGTTGGCCTGTCA
CGAGCTGATACAGTCTCTGGTTCCCGCAGATCCTCGACTTCAATATCATCTTGATTGCTTGAAGCTGACTGTGACTTCTTGCCATTAGCAGACGCTGCTG
CGCGCTTCTCTAATACATGAAGAGCTTCACTCACTCGCTCCTGCAGTTGAGTCATCTTTCGAATGCTCGCCGCGCAGTTCGTGTTGGCATTTTCTGAAAG
ATGGTTAAGGCACTTTTGCACGGTTTCCAGCTCAACCGCGAGCTTTTGAGTTTCGGCTTTTGCTGCTAGGCGCTTCTTGTTGGAGTCTTCAACTTCTCGT