Description :
From Genome Similarity Track
Location :
Scaffold_98:115512- 116639
Transcript NameFunction/comments
Phyra_54939endomembrane protein 70-like protein, putative

Sequence
1127 bases(100 bases per row)
ACATGTAGCCGAAGTAGAAGCACGTCTGCAGGAAGCCTGACATGTTGGTCTTGAAGAAATAGAAATAGATGGCGTAGATGAAGACGTAGAGCGCGGTGCT
GCCTGCTGCTGCGAAAGACGTCCAATGCCACCGGTAGTTCTCCGCGTTCAGCAGGAAGTACGTGCACACGATGGTCACGCAGAGCGTCACAATCGTCAGG
ATGATGAACACCAGCAGCATAAAGCCGTACACGTAGTAGAACTTGTAGTTCCAGAACGACGCGAAGATGAAGTACATCTCGATGAAGATGGAGCCAAACG
GCAGCACCCCCGTGAGCGCGATCAGCACCGGTGGGCGCAGATACCAACGCGCCTCGGGTACTTCACGAGGGAACTTGTTGACACGGCACGGGAAGCCTGC
CTTTGCTGCGCCGTGGCGGCCCAAGATCGTGCCCAGAACGGCCAGCGGACACGACACGAAGAACCACACCAGCACCACCTGCACGATCGTCACGAACGGG
ATGGCGTACGTCGTGCCGTAGAACACCGCGAGCGCGTTGATGAAAAATACCGACACGAACGTGACCGTGGGGAGCAGCGCCGACGACAGGCACATGGCGC
GGATCCAGTCCTTGGACACGCGCGGGTAGAAGAACTGGTGGTAGAAGGCGCCGCTCGCGTACCCGTTGGCGAGCGACGAGAACGCGTAGACGGTGAGTCC
CACGGACACGACGCCGCCGGGCTCAATGTAGAGCGACGAGCCGATGGCGATGAGCATGAGGCAGACCGAGAGCACAAGCAGCTGCGCACCCGTGCCCAGC
AGCGCCGTGAAGAGCAGCAGGTAGGGCGGCGCGCGGAACACGTCGCCGTGCAGCAGCTTCCAGCCCGAGTTGGCGTCGTCCTTGAGCAGCGACGACTTGC
CGTCCATCATGAGCTCCTCGGCGTCGTCCTCTGCGAAGCGCGCGTAGTCGTTGCGGAGCGTGCGCAGCAGGATGAGCGCCACGAGGCCGCAGAGGAAGAT
GACCATCATGAACGAGTTGAAGATGGAGAACCAGTGGATCTGGTGCTCGAAGAACTCGTCTTCAAGGTAGCGGTCGAAGCGGTCCTCGAACGCAATGGGC
GTCTCGACCCACACGACCTCGTACGTG