Description :
From Genome Similarity Track
Location :
Scaffold_847:11551- 16238
Transcript NameFunction/comments
Phypl_g11275hypothetical protein

Sequence
4687 bases(100 bases per row)
GAGTTGTGTCTGCGCAACATGTCGGCCGACTTCCAGGCCATGTCGAGCCTCACGAGCCTCGAGCACCTGcacgaggcggcgctgctgcaggcgctgagcg
agcgcttcgagcacGACCAGATCTACACTTCCATTGGGGACATCCTCGTGGCGGTCAACCCGCTCAAACCGCTGCCGAAGCTCTACTCGGAGGCACAACT
GGACGCGTACAAGCAGGTGATGGCAGACCCCAGATCGTCAGCGAGAAAGGAGCTCCCGCCGCACGTGTTTGCCATCGGTGGCAAAGCTTTCGGCGGGCTC
TTGAAGCCCGAACGACGCAATCAGAGCATCTTGGTGAGCGGagagagcggcagcggcaagacggaGAGCACCAAGTTCCTCATGCAGTTCCTGACCAGTG
TGGGGCGCGACCAGTCACGCACGGCGCAGGACGGGAGCGGCGCTGTGGAAATTGGTCGACGCATCCTGCAGACCAACCCCATTCTCGAATCTTTCGGCAA
CGCGCAGACCATCAGGAACGACAACTCGAGTCGCTTTGGCAAATTCATCAAGATCCAGTTCGGAGAGAAGAACGAGATCGTCGGCGCGCAGATCGTGAGc
tacctgctggagaaggtgcgcTTGCTGCACCAGAACCCGGAGGAACGCAGTTTCCACATTTTCtatgagctgctcgaaggagcggacaaggagctgctgg
acgcgctggggCTCCAGAAAGGAGGCAAatacgagctgctgaactcGTACGGACCTAGTTTCGCACGGAAACGCGCTGTGGCGGACAAGTACGCGCAATT
GTATGTGGAGACTGTTCGCGCGTTTGAAGACACGGGTGTCGGCGAGCAGGAACGGCTGGACATTTTCAAGATTCTGGCGGCCTTGTTACATTTGGGAAAC
GTCAAATTTATTGCCGCTGGCGGGCAGGAAGACGCTACTACTGTAACCGCGGCGTCACGGTTCCATTTGGACAAGTGTGCGGACCTCATGGGTGTAGACG
TGAACAGGCTGGAGACACTGCTGAGCAGCCGAGAGATCAAGGCTGGCATGGAAGTTATGGTGCTCAAGCATAATCCGGAGCAGGTAAAGGAGATCTGCGG
ATCGCTGGCTAAGGCTATCTATGGGCGACTTTTCACGTGGCTTGTGCGCCGTCTGAGTGACGAGATCAACTACTATGACTCGGCCATTTCGATatcggac
gaggacgaggaatTGGCGACAATCGGCATTCTTGATATATTTGGTTTTGAAAGCTTGAACCGCAATGGCTTTgagcagctctgcatcaacTATGCCAACG
AGCGACTCCAGGCGCAGTTCAACGAGTTCGTCTTtgtgcgcgagcagcaggtgtaCATTGCAGAGGGAATCGACTGGAGGAACATCTCGTTCCCGAGCAA
CGAGGCGTGTTTGGCTCTCTTTGATGACAAAAGCAACGGTCTGTTCTCACTGCTGGATCAAGAATGTCTGATGCCGAAGGGTTCTAACCAAGCCTTGAGC
ACGAAATTCTATCGGTATCACGGCGGGGTTGGGCCGCCAGACTTAGCGGGaccgcttcagcagcctcagcttGCTCAGAGCACTCTGCCGCTGTTCATGT
CGTCTTTTAGCCGCTATCTCCACCGAACCGAGTCTCAAGAGGAACCCGCTCACCAGCATACCAAGAAGCACCCTTTCTCGGCTTCGAAGATGGAACGTGT
GAAGCACCAGTTTGTGGTCCACCATTTTGCTGGACGTGTATGCTATAACGTCGAGCAGTTTGTCGAGAAGAACACTGAtgctcttcctgctgacGCGAGC
AACATTCTATCCTCTTCAAACaacgaggtggtggtggcgatTGGATCCGATGAGAATGTAGACTCGCCAGGTGCGGACAATGGAACGGCTGGGCGGAGGC
GCTACTCCATGCTGCGCGCACCTAGTGTGTCAGCTCAGTTTAAGAGTCAGCTAGACCGTCTTATTGTTCAGATTGGACGCACTGAAGCCCACTACGTTCG
TTGCCTCAAGCCGAACGAGGTTAAGAAACCCGGCATTTTCGATCGCGAAAGGATGGTAGAGCAAATGCGCTCCGTTGGTGTGCTCGAGGCAGTGCGTATC
GCGCGTCATGGGTACTCTATGCGTCTCGCGCACGCGAGCTTTGTCGAACTGTTCTCTGGATTCAAGTGCTTCTTGAACACGCGAGACCGATCGACGAAAT
TAAATAACCATGACTTGGCACAAGCGTTAGTGACTGTCTTGATGGACAAGGTGCTTCTGGAAGACGGTGTGACGCGAGAAGAGAAGAACCCAGGCGCTCT
GACTGCAGTTACTGATGACGGCAGCGGCACAGCTTTCGAAAACGACATTCGTCGTAAGGACGTGCAGGTGGGCAATACACTTGTGTTTTGTAAATCCAGC
ACTTACAACCAGTTTTCTCGATaccgcgtggagctgcgaATCCATTGCGCAACAGCGCTACAGAAGCATTACCGTGGCTATCGACGTCGGGTATTATATC
GAGAGCTGCGCGATTTTGTGGTACACGTGCAAGCGATTGTCCGAGGATTCCTAGGAAGGAGACGAGTGAgcaagctgcgccagcttcgccgcGAAAAAGC
TGCCACTCAAGTCCAatcgtgctggagacgcttTGTGGCGCGGCGCAAGTTTGCTGAGATGATTAAGCACAAGCGCCagatggcagcagccacgctcATT
CAGACTCACTTCAAACGTGTGTTGGCACAACGAATGCTTGCAGAAATGCTGAAGGATCAACgccagctcgctggtgccATCCGTATTCAAGCGAACGTCC
GACGTTGGGTAGCACAGCAGAAGTTAGCAGAGCTTCGAAAGCAAAAGCTTCacgttgccgctgctgttcacATCCAAACAAGTTGCCGGCGTTGGCTGGC
ACAACGGGAACTTACCCGACTTCGGGAGCAAAAGCTCCagattgctgctgctgtccacaTACAAGCGCAATGCAGACGTTTGCTGGCTCGACGACAGTGT
GAGAAGCTGCGACGCCATAAGCTCGAGGTATCTACAGCGATTCGAATTCAAGCCCAGTGCAGACGTTGGATCGCACTGCGAAAGTGCGATCAATTGGTAC
AGGAAAAACGTGAATTTGATGCTGCTATCATCATCCAGAGGCAAAGCAGGCATTGGCTCGAGCAGAACAGCTATGTATCGGCGAAGCTCCAGCATTTCCG
CTTAAACGTGGCGTTCGGCAAGTTCCGACGCGCATGCCAGGTTTCTCGGGTGGCAAGTGAAATGGAGGCCGAGCCTTCCCCCAGTGACGACTCTTCAGCG
AGCCGAGCGAAGCCACTCATGTCCAAATCAATTGGCCTTCCAGCTACCCAGTCAAGCTCGGACAGTTCTGCCAGTGACGACCGGATGGAGGCCCCACTTC
GTATCTCCGCTCCCACACATCGCCGCACCAACAGCAGACAGCGTAGTCGCGTAACCAGTCGACACCGTAATCGTGCAAGTAGCAGCCACGTCGATGATcg
caactcgctgctggagaacgaaATCTTGCGTTTGCAGCAGATGCTCATGGAGCAACAAAATGGGAACGACGTGCGTCCCCCTCGGGACCAAAGGCGTCAG
TCGTCGGTGCttgctcgtccacctcggaGTGCCCCGCTTGACTTAGGTCAGTCCTCCCGCGCAACGCACTCGCGTTCTGGCCGTCGTCGGTACTCAGTGG
ACGGCGTCCTATCCGAGGATGAGGACGGGGAGAATGACGACGAGGTGTCGTTGTTGCCGCCGCGTCGTGCTCGCAGTGTCATGCCTGCACTGCAGGCCGA
CCACGTTTCCATGCTGTCGcagaagatcgaggagctggacgctAAGTGCAAGTTTCTGGAACAGCTCGTGGCGCgcaagaacgacgaggacgcggcgaGA
GAGTCCTTTATATACGGCCGAGGATCGCTTGGCGGTAGGGAGCGTTTCTCCTCTGCGGATGGATCATTGTACGGCGACACTCCCCCGAGCGAAGCGGGCT
CGGACGTGGACTCGATCATCTTCAACATCCAGAGCCAGATGAACATGCTGCGGCAGTCGATCgcggtgaaggagcaggTACTCCAGACGTCTCGCAAGTC
GCACGCCATGTCGTTTTCATCCAGCACTCGGCCAACGCGGTCTTCGTCAGCTGCGTCGACGATGTCGTTCTCAAACATGCCCATGGGCGAGGCCCCGCCG
AGTCTGCCGTCGCTCCCGCTCTCCGAGTCGCAACTTTCAGCTGGCGGGTCATCGCGTGGTAACGGCCCGCGCAGTGGTGGCAGCTCCCTCGGTCTTCCGC
CTACGCCGACATCATCTGTGGCGTCCTCGTTCTACCAAGGCCCTCCCCGTTCTGCACCTGCGCACTTTGGCGGCCGTGGCATGCCTCGCATCGTCAAGTG
GGCGCGTTCCACCAACTGCTACGAGTGCGAGGAGTCGTTCAACCTATTCGTGCGGCGACACCACTGCCGTATGTGCGGCAACTCGTTCTGCCACGAGCAT
TCCAGTCGGCGTGTGTCTGTCTTCGGCATTGGCTTCGACGACGAACCTGTTCGCGTGTGTGACAACTGCTTCGCCGAGTATTATGCAGCGTCGCAGGAGC
CGCTCACGCCGCAGTACCCCCCTCAGTATGGCTTCAGCTCCGGTCCACTGTCCACGTCTTCGCGTCTCAGCGGTTTGTAGTTAGTGA