Description :
From Genome Similarity Track
Location :
Scaffold_779:1155- 7872
Sequence
6717 bases(100 bases per row)
CTCACCCAGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCATCTTCGGAGCCCCGAGAGAGCATA
TCCAGCCCGCCGACGGGTACACAAGGTGAGAACAAGTTCAGCCGATCACGGATCGTTGGGGGCCCCCCTCCGTTAGTCGGTGTCTGGGCGCTGGTGGGAA
GCTCGATCAGGCCTTAACCAGATTTTGGCCGATCCCGCTACACCACAATGGTGTGCGTGCCCGGATTCGAACCAGGGATTCACCGTGAGTCCGTAGAAGA
TGCGCAAGTGAAGAAAGAACCAGGGGAAGAGGCGTCGTCGGATATCGGATCAACGAAGACGCTGCTGAACAAAACGAGATCCGCGGATCGACAGAGTGCT
CGGAGGACTTCTGTCGACGGAATCGAGGGCGATCTGGAGACAGATCTAGAAGACAAACCTCAACATCCTCCACAGGTCCCTTCGGGGACCCCGGTGGATC
TTGGTGCGAACCGAGATTCACTAACAAAACAAACTAAGGCGGGATCAGACCGATACGCGTTCGCCGACTCGCCGATCAGGCTCGATCCGGACTACCTGGA
CGCGATCGCGGACAAGGACCAGATTGTGAGGAAGAAGCTGAGAGCGCCAGGCCTGGACGACGAAAATCCCAGACCGTCGGCGCTCGACTGGTCCGAGGCT
GACCTGGATCGTCAGTATCACTTGAAGGAACTGCGAGACTTCTTGCGTCAAGATCCCGTCATGGTGATCTTGCGGCCAGAGCAGATCGACGACCCGAAGG
GCCCGATCTCGGCCCCCCGAGTGGCGGACAACAAGCTGATGGCGGTGAAGAACCTGCTCGGACTGTTGAAGGAAGCCGGCTTCGTGGCTGGCGCCTTTGA
AGCGAATGATCTTTTCGATCAGGATCTCGATGTGATCCAGACAGCGATCCAGACATTGGTCGACAAGTTGAGACCTTTGGTCGACGTGATCGCGGACAGT
CCGGACCCGAAGGTGCCAGATCTAGTGTCGCCAGCTCCCGCGTCGTCGCCGCGGATGGAGTCCACTGGGTACCGATCGTCGTCTCCTTATGTCTCCGCAG
CGGAATACGTATCGGATACGTCGTCTGAACCTCAACGGATGTCCCTCGGCCCTTCAGGATCTGCGATGTTGGACGCACGATGACGGAGTCAACGTCAGGA
ACGCATGCGATCAGGACCTCGGAAGCAGAAACCCAAGTCGACCGATCGGACCACCAGTACTACCGGATCAGATGAGTCGACTGGCAAACTGGAGTCTTCG
CGGGACGTGGAGATGGAATCAGCCGGATCGCCGGATCAAGATCTCTCTCAGTAGGAATACAATCCGGACGACATTGATCTACCGAGTTCAGCCCCTGCTG
CGGTGGCCACCGCTGCCTCAGGATCCACTGGGTCCTCATTGATCCAGCGTGGGCGGATTTCGGCGATGTCCGATCTTAAGGAGTTCAATGGCAAGGATCA
GGACGAAGACCGCGGCCGATCGTGGATCAGCAAGGTAAAGTCGGCGTTCCTGCGAAATCAGACTACGGACGAAGAGAAGTGCCTGACCTTTGCTGATCTA
CTGACGGGCCCGGCGAAGAACTGGTACCACCAGCTGGGCCGATCGACGCGGATCAAGTGGAGCGATCTACTCCGGAGTTTCCAGATCCAGTATTGTGGCC
TGGGAGTATCGGTCGCTTGGCAGTATTACCATTCTCGCAAGAGATCAGATGAATCGCCGTTGGAGTACCTCTATCGACTGAATGTGGCGGCTCTGCGTGC
GAGATTGAAGATCAAGGACGGAGATTCCAAGGCCCGCAGAGAACATGTCGAACACTTTATCGAGACGCTGGGCGATCCGGAACTGGCCGATCGTACTCCG
GCTTGCGGACGCAGAAGATCTGGAGGAAGTCCTACGCGCTCGAGAGCGCGCGATGAGCAGACAGAAGCGATCCGCCTTTGGATCGAAGTATCGTCAGAAG
GTTCCGACCTCAGCACCAGCTGCTGCAACCAAGCGGGCAGTGCGTGCAGCGCAGATCGCGAGCCAGGAGTCTGGATCGGACACGGGATCAGACGGATCGG
ACTCGGAGGGTGATCTACGTCGCGTTTACCTAGCGTCGACCGAGGACAAGTCCCGTAACGCTGGGGGCGACGCGACGAAGCCGGATCGAATCAACCAGGC
GCAGATCAACCATGACCCACCTCGATCGGATCCACGATCGCGATCTTCACCTGACGGATCGGAGCGATCAAACCGCTGCTCACATTGTGGATCGCGGAAA
CACACCGATCTCGATTGTTGGAGACGTTTGACGTGCGAGAAGTGCGGCAAGAGAGGTCATCCGGCGGATCGCTGCCTGTTTGTGTGCCGTGGATGTGGTG
AACTACACGAGATGGGCAAGTGTCCGATGGAGGAATTCTACAACCAGATCCGTCAATGGTTCAACCCGGTGAAGCACGCTGGCATGTTGCCCGCGATCGC
CGAGAAGATGTAAACTA