Description :
From Genome Similarity Track
Location :
Scaffold_1491:1155- 4476
Sequence
3321 bases(100 bases per row)
CAATGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGAGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAGGCGGAGTATAACGGACTC
CTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCGAAAAGGTTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGCGAGATTGACT
GCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATTTACCTGCGCGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGC
CAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAATTGGAGAGAGAGGCCGAGCATCAGGATCCCGTTACGTTGAACCGACTA
GACGAAGTGGTGGTAGTGGGGTCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTCGATCCAACCCCCAAATTCTCGAGG
AAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACG
AGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCCCCTCTACGAAGAGA
GTCAACGAGGATCGGGATGGATTAATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATC
AGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGA
GACAGGCAAGAGCAGGCCCACAATCGAAGGGAGGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTG
CCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAGACCATTGCTGAATCG
TACGAGGAGTGCGTTTTTCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGA
TCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACGAGAGCACTCAAGATGTA
TGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTT
TACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGACCATTCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACC
AAGTCCAAAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGGCTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTCC
ACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGG
GTGAGCTAGAAGATTGGAGAACACGCGGTTAAGCTGGAAACGGCAGGTACCGAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTCGGTCA
AACAATATCCGGATCGGCCGCAGATCTGTCTTTCGGTGGATGGATCCGATCGCGTCGACTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGA
TCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGATAGGGAAAACGAACTAGATACGGACGGGTTTATAGTTAATTTCTGGTGTATTGG
CGTGGATATGACGAACCCAGTTGGATAGACGAGGCAGATCTGAACTGTGGAACATTACTCTATGATTTCTTGAGGGATCGTACGAACCGTAACAGATTCG
GCGTGATGCAGTCTCATGAAGAAAAGTAGGAAGGGACCCATGGATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACAGGAAGGGTGTGGG
CCAGGAGGAGGAGGATCGCTGATGTGAGTTGGTAACATCGGAAAGAAAGAGAAGACGAATCCACAGGGGAAGGGTGGATTAGGAGGAAGGAGCGAATGTT
TATGCATAAGAGTGACGTTTTACGTGCGAGGAGTCCTGTTTAATCTCAAGCATGAGCTTTGAAGGGCCCGAACTATACTGACCCGATTGCCTACTGGGTC
ATTGGCGCTAGATCCGGATGAAATCCAGTCGCAGATCCAATCGGATCCGGGATCCCGCCCAAATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGAT
CCAGGTGTACACTGAAAGGCCCGGACTAGATTTCTCAACCAACGAGGGAATGTTATAGACATATTCAAGTAAGAGAGAGTGGATTATGATAGCTTATGCA
AAGGGCTAGCTCGACCCAGTTTCCAGTCGCTAGTTACGGCTACGAAATGAATCCACGAAGACTGAAACTGGGGGGCGTGGCGTCAAAGAGTGATGAGGAT
CAGGTAGTCTTGGGCTGAACGTTGAAGAACTTGCCCACTAGACGCTGGATCTGGCGTCCTGGGTGTCGGCTCGGGTCCCCGCGAAACTGGATGCGCCAAG
GTTCGGCTTCGTCGATCTCTCGCAAGGCTTCCAGTAGGTTCGTGGGTTCTGGGAGATGGAGGTTGGGGTCCTCCAAGTTGGCTTGACGGGATACGGATCC
CGGAAACCAAGCCACCTTATCTCCGCGTCGGGGAAGATGCAAGAAGGATGGATCCAACAAAATATTCACGTCACACCAACCGTCCTGGATTGCCAACACG
AGGATCACAAGGACTCTCTTCCAAGCTCGGCCAGCATGGCTACGTCGGTTACCACGCTGCTTGTTGAAGTTAGACAACCAAGTCGAACCCTGCAGTTGAT
TCCGAGAGATGGGAACCGGTGAGTGCCCTCCCATATAGCAACCCGGTGCTTGGATACGAAATCCCGGAACGCACGAACGAATACCCCGAGTCGCCCACGC
ACATCACCCCTGAAGCTAACCGGATCCACCGGTGTGGTGACCAGCGTATCCCACGGGGCAGCACTTGTCAGTTCTTCCACGAGAGGTCTGGTGACGAGCG
AATCCAGGTACCCGGCCCTCG